Effects of Fractalkine/CX3CR1 system on the development of obesity

Ágnes Polyák

(Supervisor: Dr. Krisztina Kovács) polyak.agnes@itk.ppke.hu

Abstract—Obesity is characterized by, among others, chronic low-grade inflammation, immune cell infiltration into adipose tissue, proinflammatory cytokine production, insulin resistance.

Fractalkine is a chemokine, which participates in attraction and adhesion of immune cells. The mechanisms by which monocytes traffic to adipose tissue are incompletely understood and a key question in the field. We investigated the effects of fractalkine receptor deficiency in the development of obesity. After 10 weeks of high fat diet or normal chow feeding glucose tolerance test was performed on fractalkine receptor deficient (CX3CR1 GFP/GFP) and control (CX3CR1 +/GFP) mice. Afterwards they were sacrificed, organs were harvested. Histological and real-time PCR analysis was used to reveal the differences between groups.

We found that lack of fractalkine/fractalkine receptor system attenuated the symptoms of obesity: CX3CR1 GFP/GFP mice gained less weight, epididymal fat pads and average adipocyte size were smaller, produced less chemokines and proinflammatory cytokines and did not develop insulin resistance. Compared to others’ our results suggest that lack of fractalkine signaling may slow down the development of obesity and attenuates comorbid immune-related alterations.

Keywords - obesity, high fat diet, fractalkine, CX3CR1 Abbreviations - CX3CL1/FKN-fractalkine, CX3CR1-fractalkine receptor, GFP-green fluorescent protein, ATM-adipose tissue macrophages, HFD-high fat diet, ND-normal diet, MCP-1-monocyte chemoattractant protein-1, IL-interleukin, TNFa- tumor necrosis factor alpha, GTT-glucose tolerance test.

I. INTRODUCTION

High-fat diet (HFD)-induced obesity has emerged as a state of chronic low-grade inflammation characterized by a progressive infiltration of immune cells, particularly macrophages, into obese adipose tissue. Adipose tissue macrophages (ATM) present immense plasticity. In early obesity, M2 anti-inflammatory macrophages acquire an M1 pro-inflammatory phenotype. Pro-inflammatory cytokines including TNF-α, IL-6 and IL-1β produced by M1 ATM exacerbate local inflammation promoting insulin resistance, which consequently, can lead to type-2 diabetes mellitus.

However, the triggers responsible for ATM recruitment and activation are not fully understood. Adipose tissue-derived chemokines are significant players in driving ATM recruitment during obesity. [1]

Fractalkine, a chemokine that signals through a single known receptor (CX3CR1), is expressed on numerous cells: on activated endothelial, smooth muscle cells, macrophages, and adipocytes [2]. It is synthesized as a trans-membrane protein

with the CX3C chemokine domain displayed on an extended highly glycosylated, mucin-like stalk [3, 4] (Fig. 1). The transmembrane form of fractalkine is capable of mediating adhesion of cells expressing the G protein–coupled receptor CX3CR1 [2] and it mediates monocyte adhesion to human adipocytes [5]. A soluble form can be released from its membrane form by extracellular cleavage and then act as a classical chemoattractant for CX3CR1 expressing leukocytes. The expression of fractalkine has reportedly been enhanced by inflammatory stimuli, i.e., TNF-α, interferon (IFN)-γ and lipopolysaccharide [2].

Figure 1. Transmembrane and soluble form of fractalkine, and its receptor: CX3CR1 [6].

II. MATERIALS AND METHODS

A. Animals and diet

Experiments were performed in male CX3CR1 +/GFP, and CX3CR1 GFP/GFP mice. CX3CR1 +/GFP mice was used as control group as there were no significant difference between +/GFP and +/+ mice in previous experiments. CX3CR1/GFP mice were obtained from the European Mouse Mutant Archive (EMMA), backcrossed for more than 10 generations to C57Bl/6 [7]. In these mice, the cx3cr1 gene was replaced by a GFP reporter gene. At 35 days of age both CX3CR1 +/GFP (n=8) and CX3CR1 GFP/GFP (n=10) mice were randomly distributed into two equal groups. The first group, normal diet (ND), received standard chow (VRF1 (P), Special Diets Services (SDS), Witham, Essex, UK). The second group, high fat diet (HFD) was given standard chow mixed with lard (Spar Budget) (2:1) for 10 weeks. The mice were housed in groups of 4-5. Animals had free access to food and water and were maintained under

Figure 6: aTime course of the effect of VGCC cocktail on Ca2+ responses in the input (green) and lateral dendritic (magenta) regions. b, The same as a

700 740 780 820 0

700 740 780 820 8

MNI-Glu DNI-Glu

MNI-Ulg DNI-Ulg Electrophysiology Ca²⁺- imaging

150%ΔF/F

c input region lateral region d

500 1000 1500 2000 VGCC cocktail

input region

time (s)

normalizedΔF/F

200 400 600 800 1000 0.4

1.2 TTX

lateral region input region

Effects of Fractalkine/CX3CR1 system on the development of obesity

Ágnes Polyák

(Supervisor: Dr. Krisztina Kovács) polyak.agnes@itk.ppke.hu

I. INTRODUCTION

However, the triggers responsible for ATM recruitment and activation are not fully understood. Adipose tissue-derived chemokines are significant players in driving ATM recruitment during obesity. [1]

The expression of fractalkine has reportedly been enhanced by inflammatory stimuli, i.e., TNF-α, interferon (IFN)-γ and lipopolysaccharide [2].

Figure 1. Transmembrane and soluble form of fractalkine, and its receptor:

CX3CR1 [6].

II. MATERIALS AND METHODS

A. Animals and diet

The mice were housed in groups of 4-5. Animals had free access to food and water and were maintained under

Á. Polyák, “Effects of Fractalkine/CX3CR1 system on the development of obesity,”

in Proceedings of the Interdisciplinary Doctoral School in the 2012-2013 Academic Year, T. Roska, G. Prószéky, P. Szolgay, Eds.

Faculty of Information Technology, Pázmány Péter Catholic University.

Budapest, Hungary: Pázmány University ePress, 2013, vol. 8, pp. 59-62.

controlled conditions: temperature, 21°C±1° C; humidity, 65%; light-dark cycle, 12-h light/12-h dark cycle, lights on at 07:00. All procedures were conducted in accordance with the guidelines set by the European Communities Council Directive (86/609 EEC) and approved by the Institutional Animal Care and Use Committee of the Institute of Experimental Medicine.

B. Experimental design

Mice were fed with ND or HFD for 10 weeks, body weight and food consumption was measured weekly. In the 10th week glucose tolerance (GTT) test was performed after overnight fasting. Two days after the GTT, mice were decapitated, trunk blood was collected, organs were harvested and stored at -70°C for RT-PCR, or fixed in 4% PFA for histology.

C. Glucose tolerance test

Mice were fasted overnight (15 h) and then injected intraperitoneally with 2 mg/g of body weight D-glucose (20%

stock solution in saline). Blood glucose was measured from tail vein by DCont Personal Blood Glucose Meter (77 Elektronika Kft. Hungary) at 0 min (just before glucose injection) and at 15-, 30-, 60-, 90- and 120-min intervals after the glucose load.

D. Histology

Tissues were fixed by immersion in 4% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4 (PB) for 3 days. Subsequently, they were stored in 1% paraformaldehyde in 0.1 M PB at 4°C.

Tissues were paraffin-embedded, sectioned and stained with H&E stain. Slides were digitalized with Pannoramic Digital Slide Scanner (3DHISTECH Kft., Hungary) and analyzed with ImageJ software (NIH, USA).

E. Quantitative real-time PCR

Total RNA was isolated from epididymal white adipose tissue (EWAT) samples with QIAGEN RNeasyMiniKit (Qiagen, Valencia, CA, USA) according the manufacturer’s instruction.

To eliminate genomic DNA contamination DNase I treatment was used (100 ml Rnase free DNase I (1 uDNase I, Fermentas) solution was added). Sample quality control and the quantitative analysis were carried out by NanoDrop (Thermo Scientific). Amplification was not detected in the RT-minus controls. cDNA synthesis was performed with the High Capacity cDNA Reverse Transcription Kit (Applied

Biosystems, Foster City, CA, USA). The designed primers (Invitrogen) were used in the real-time PCR reaction with Power SYBR Green PCR master mix (Applied Biosystems, Foster City, CA, USA) on ABI StepOne instrument. The gene expression was analyzed by ABI StepOne2.0program. The amplicon was tested by Melt Curve Analysis on ABI StepOne instrument. Experiments were normalized to Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression.

F. Primer design

Primers used for the comparative CT (threshold cycle) experiments were designed by the Primer Express 3.0 program. Primer sequences were the following:

GAPDH:f: TGA CGT GCC GCC TGG AGA AA MCP-1: f: CCAGCACCAGCACCAGCCAA

r: TGGATGCTCCAGCCGGCAAC FKN: f: CCG CGT TCT TCC ATT TGT GT

r: GGT CAT CTT GTC GCA CAT GATT GFP: f: GGA CGA CGG CAA CTA CAA GA

r: AAG TCG ATG CCC TTC AGC TC G. Statistical analysis

The results are shown as means ± SEM. Statistical analysis was performed by factorial ANOVA with Newman–Keuls post-hoc test in Statistica 11 (StatSoft Inc.); p < 0.05 was considered significant.

III. RESULTS

A. Body weight change, adipose tissue weight and food consumption

HFD feeding leads to excessive body weight gain in control (+/GFP) mice. CX3CR1 deficient mice gained lower body weight in HFD fed group at the 8^thto 10^th weeks (Fig. 2A), although there were no difference in total food consumption (Fig. 2B). Epididymal adipose tissue (EWAT) fat pads were significantly larger in HFD groups, but in GFP/GFP mice they were smaller compared to +/GFP mice (Fig. 2C).

Figure 2. (A) Weight gain during 10 weeks of HFD. (B) Total consumed food during the diet. (C) Relative EWAT weight at the end of the experiment.

* p<0.05, ** p<0.01, ***<0.0001 vs. ND, # p<0.05, ###<0.001 vs. GFP/GFP.

B. Glucose tolerance test

In GTT blood glucose level increases after intraperitoneal glucose load, which is followed by plasma insulin release. In normal diet fed mice insulin decreased the elevated blood glucose level, and after 120 min it returned to normal level.

HFD induced glucose intolerance in control group, the blood

Rel. EWAT weight (AU)

Diet

***###

A B C

glucose level remained high. Lack of CX3CR1 prevented the development of glucose intolerance (Fig. 3).

Figure 3. Results of Glucose Tolerance Test. * p<0.05 vs. ND, # p<0.05 vs.

GFP/GFP.

C. Histology

HFD feeding resulted in 3.4 fold elevation in adipose cell size in +/GFP mice, and 2.38 fold elevation in GFP/GFP mice vs.

ND mice (Fig. 4). CX3CR1 deficiency resulted in smaller cell size expansion (p<0.001) in HFD fed mice.

Figure 4. (A) Average adipose cell size in EWAT, arbitrary unit. ***

p<0.0001 vs. ND, ### p<0.001 vs. GFP/GFP. Adipose cells in EWAT H&E staining 20x magnification, (B) CX3CR1 GFP/GFP + ND, (C) CX3CR1 GFP/GFP + HFD, (D) CX3CR1 +/GFP + ND, (D) CX3CR1 +/GFP + HFD.

D. Quantitative real-time PCR

The levels of chemokines participating in monocyte recruitment and the level of GFP, which refers to the amount of CX3CR1 expressing macrophages, were elevated in HFD fed mice. CX3CR1 deficiency resulted in smaller level of monocyte chemoattractant protein 1 and fewer macrophages (GFP positive cells) (Fig. 5).

Figure 5. Chemokines (MCP-1, FKN) produced by epididymal adipose tissue. Rate of GFP+ monocites in EWAT. * p<0.05, ***<0.0001 vs. ND,

###<0.001 vs. GFP/GFP

High fat diet increased proinflammatory cytokine production in adipose tissue. Relative mRNA levels of IL1a, TNFa were significantly less elevated in CX3CR1 deficient mice (Fig. 6).

Figure 6. Proinflammatory cytokines produced by epididymal white adipose tissue. * p<0.05, ** p<0.01, ***<0.0001 vs. ND, # p<0.05, ###<0.001 vs.

GFP/GFP.

IV. SUMMARY

We investigated the effect of CX3CL1/CX3CR1 system on the development of obesity. To induce obesity, we fed CX3CR1 +/GFP and CX3CR1 GFP/GFP mice with high fat diet for 10 weeks. HFD resulted in excessive body weight gain, impaired glucose tolerance, enlarged adipose cells, elevated chemoattractant levels, GFP positive cell infiltration into adipose tissue, and elevated proinflammatory cytokine production in control group (+/GFP). Lack of CX3CR1 attenuated the metabolic and immune symptoms of obesity. HFD fed CX3CR1 GFP/GFP mice did not gain more body weight than control, normal fed mice, although their epididymal adipose tissue, and adipocyte size was larger. They did not develop glucose intolerance and produced less chemokines and proinflammatory cytokines than CX3CR1 +/GFP mice.

In an experiment performed by Morris et al. [8], after 20 weeks of HFD, mice developed obesity induced insulin resistance and CX3CR1 deficiency did not alter the monocyte trafficking into adipose tissue.

These results suggest that lack of fractalkine may slow down the development of obesity.

Average EWAT adipose cell size (AU) GFP/GFP

+/GFP

Relative mRNA level (AU) MCP-1

GFP/GFP

IL1a IL1b IL6 TNFa

Relative mRNA level (AU)

GFP/GFP

61 controlled conditions: temperature, 21°C±1° C; humidity,

65%; light-dark cycle, 12-h light/12-h dark cycle, lights on at 07:00. All procedures were conducted in accordance with the guidelines set by the European Communities Council Directive (86/609 EEC) and approved by the Institutional Animal Care and Use Committee of the Institute of Experimental Medicine.

B. Experimental design

C. Glucose tolerance test

Mice were fasted overnight (15 h) and then injected intraperitoneally with 2 mg/g of body weight D-glucose (20%

D. Histology

Tissues were fixed by immersion in 4% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4 (PB) for 3 days. Subsequently, they were stored in 1% paraformaldehyde in 0.1 M PB at 4°C.

E. Quantitative real-time PCR

Total RNA was isolated from epididymal white adipose tissue (EWAT) samples with QIAGEN RNeasyMiniKit (Qiagen, Valencia, CA, USA) according the manufacturer’s instruction.

F. Primer design

Primers used for the comparative CT (threshold cycle) experiments were designed by the Primer Express 3.0 program. Primer sequences were the following:

GAPDH:f: TGA CGT GCC GCC TGG AGA AA MCP-1: f: CCAGCACCAGCACCAGCCAA

r: TGGATGCTCCAGCCGGCAAC FKN: f: CCG CGT TCT TCC ATT TGT GT

r: GGT CAT CTT GTC GCA CAT GATT GFP: f: GGA CGA CGG CAA CTA CAA GA

r: AAG TCG ATG CCC TTC AGC TC G. Statistical analysis

The results are shown as means ± SEM. Statistical analysis was performed by factorial ANOVA with Newman–Keuls post-hoc test in Statistica 11 (StatSoft Inc.); p < 0.05 was considered significant.

III. RESULTS

A. Body weight change, adipose tissue weight and food consumption

Figure 2. (A) Weight gain during 10 weeks of HFD. (B) Total consumed food during the diet. (C) Relative EWAT weight at the end of the experiment.

* p<0.05, ** p<0.01, ***<0.0001 vs. ND, # p<0.05, ###<0.001 vs. GFP/GFP.

B. Glucose tolerance test

HFD induced glucose intolerance in control group, the blood

Rel. EWAT weight (AU)

Diet

***###

A B C

glucose level remained high. Lack of CX3CR1 prevented the development of glucose intolerance (Fig. 3).

Figure 3. Results of Glucose Tolerance Test. * p<0.05 vs. ND, # p<0.05 vs.

GFP/GFP.

C. Histology

HFD feeding resulted in 3.4 fold elevation in adipose cell size in +/GFP mice, and 2.38 fold elevation in GFP/GFP mice vs.

ND mice (Fig. 4). CX3CR1 deficiency resulted in smaller cell size expansion (p<0.001) in HFD fed mice.

Figure 4. (A) Average adipose cell size in EWAT, arbitrary unit. ***

p<0.0001 vs. ND, ### p<0.001 vs. GFP/GFP. Adipose cells in EWAT H&E staining 20x magnification, (B) CX3CR1 GFP/GFP + ND, (C) CX3CR1 GFP/GFP + HFD, (D) CX3CR1 +/GFP + ND, (D) CX3CR1 +/GFP + HFD.

D. Quantitative real-time PCR

Figure 5. Chemokines (MCP-1, FKN) produced by epididymal adipose tissue. Rate of GFP+ monocites in EWAT. * p<0.05, ***<0.0001 vs. ND,

###<0.001 vs. GFP/GFP

High fat diet increased proinflammatory cytokine production in adipose tissue. Relative mRNA levels of IL1a, TNFa were significantly less elevated in CX3CR1 deficient mice (Fig. 6).

Figure 6. Proinflammatory cytokines produced by epididymal white adipose

In document Proceedings of the Doctoral School, Faculty of Information Technology, Pazmany Peter Catholic University (Pldal 58-62)