in the Teaching Material of
Medical Biotechnology Master’s Programmes
at the University of Pécs and at the University of Debrecen
Identification number: TÁMOP-4.1.2-08/1/A-2009-0011
RECOMBINANT PROTEINS
Beáta Scholtz
Molecular Therapies- Lecture 3
in the Teaching Material of
Medical Biotechnology Master’s Programmes
at the University of Pécs and at the University of Debrecen
Identification number: TÁMOP-4.1.2-08/1/A-2009-0011
1.1 OVERVIEW: PROTEIN PHARMACEUTICALS
1.2 CELL-FREE SYSTEMS: IN VITRO TRANSCRIPTION AND TRANSLATION 1.3 EXPRESSION OF RECOMBINANT PROTEINS IN CELL CULTURE
1.4 NON-PROKARYOTIC EXPRESSION SYSTEMS 1.4.1 Pichia pastoris
1.4.2 Protein expression in insect cells
RECOMBINANT PROTEINS
The aim of this lecture is to describe the in vitro and in vivo systems utilized for
expression of recombinant proteins, and discuss the advantages and disadvantages of these systems. We will also discuss the basics of affinity-tag based protein
purification.
4
Pure protein preparations
Uses: medicine and research Sources:
• natural protein mixtures - human/animal/fungi/plant
• artificial preparations - synthetic peptides, recombinant proteins
Insulin Pigs or cattle (pancreas)
Factor VIII Human blood (donated) Human growth hormone Human brains
Calcitonin Salmon
Anti-venom Horse or goat blood Protein pharmaceutical Natural Source
Equipment used for blood
fractionation
6
B. Rogge Box jellyfish,
Australia
Lonomia caterpillar, Brasil
R. Morante
Black scorpion, Arabia
P-A. Olsson
Antivenom - specific antiserum from goat or horse
pharmaceuticals
Natural sources are often rare and expensive Difficult to keep up with demand
Hard to isolate product
May lead to immune reactions (diff. species) Viral & pathogen contamination
Most protein pharmaceuticals today are produced recombinantly
Cheaper, safer, abundant supply
8
Peptide drugs
Many hormones are actually small peptides (2-40 amino acids) Calcitonin (32 residues)
Thyroid hormone to enhance bone mass Oxytocin (9 residues)
Pituitary hormone to stimulate labor Vasopressin (9 residues)
Pituitary hormone for antidiuretic/vasoconstriction
Peptide drugs
Small enough to synthesize using solid phase chemistry (SPPS) Method developed by Bruce Merrifield in 1960’s (won Nobel
prize)
Very efficient synthesis (>99%/couple) Still: 50 residue peptide, 99% coupling
Yield = 0.9950 = 60.5%
Technique limited to small peptides
10
Recombinant proteins
Developed in 1970’s &1980’s
Paul Berg (1973) restriction enzymes
Herbert Boyer (1978) cloning human insulin into E. coli – Genentech
Four general approaches
Expression in cell-free systems
Expression in isolated cells
Expression in transgenic plants/animals
Gene therapy in humans
Cell-free systems:
In vitro transcription and translation
• Rapid identification of gene products
• Functional analyses
• Analyze protein-protein interactions
• Study protein folding
• Incorporate modified amino acids for functional studies
• Engineer truncated gene products
12
Advantages over in vivo gene expression:
When the protein is:
toxic to the host cell
insoluble or forms inclusion bodies degraded rapidly by intracellular proteases Speed and directness of all procedures
Absence of constraints from a living cell Pure product
Disadvantages over in vivo gene expression:
Lack of cellular membranes
Lack of post translational modifications
Cell-free systems:
In vitro transcription and translation
transcription
• Linearized DNA template
• Phage RNA polymerase
• 4dNTP
• Buffer
In vivo In vitro
14
Phage RNA polymerases
Phage Polymerase Host of Phage Promoter Sequence
T7 RNA polymerase E. coli 5’TAATACGACTCACTATAGGG 3’
T3 RNA polymerase E. coli 5’AAATTAACCCTCACTAAAGGG3’
SP6 RNA polymerase Salmonella
typhimurium 5’AATTTAGGTGACACTATAGAA3’
Characteristics of RNA polymerases
RNA polymerases proceed at a much slower rate than DNA polymerases.
RNA pol (50-100 bases/sec) DNA pol (1000 bases/sec)
The fidelity of RNA synthesis is much lower than that of DNA.
RNA polymerases do not contain proofreading mechanisms.
16
DNA template
Plasmids
Many commonly used cloning vectors contain phage polymerase promoters outside of the multiple cloning site.
PCR Products
Primer must
contain promoter Oligonucleotides
Linearization of template
• Plasmids: no RNA polymerase termination signal; templates are linearized
• PCR template: termination signal in the amplified region OR in the primer
18
Translation in eukaryotic cells
1998 by Alberts et al.
Published by Garland Publishing.
• tRNA & aminoacyl-tRNA synthetases
• Ribosomes
• Amino acids
• ATP, GTP
• Initiation, elongation, and termination factors
• Buffer
• RNA template
Components for in vitro translation
Much more complex than transcription
Cannot be mixed from a few isolated components Always provided as crude extract of cells
20
Common in vitro translation systems
Rabbit reticulocyte lysate Wheat germ extract
E. coli extract
Rabbit reticulocyte lysates
Reticulocytes:
immature red blood cells no nuclei (DNA)
complete translation machinery, for extensive globin synthesis
Endogenous globin mRNA can be eliminated by incubation with a Ca2+dependent micrococcal nuclease. The nuclease is later inactivated by EGTA.
Low background
Efficient utilization of exogenous RNAs, even at low concentrations Low nuclease activity
Capable of synthesizing large amounts of full-length products Capable of translating either capped or uncapped RNAs
22
Wheat germ lysates
Low background incorporation due to low levels of endogenous mRNA
Recommended for translation of RNA containing small fragments of double-
stranded RNA or oxidized thiols, which are inhibitory to the rabbit reticulocyte lysate
Generally more cap dependent than reticulocyte systems
Often preferable when synthesizing relatively small proteins (12-15kDa) that comigrate with globin, which is abundant in reticulocyte extracts
E. coli lysates
Simple translational apparatus and less complicated initiation control mechanisms
BUT: bacterial extracts contain nucleases that rapidly degrade most exogenous RNAs
Extract must be incubated during preparation so that excess endogenous mRNA is translated and subsequently
degraded
The exogenous product is easily identifiable
24
Translation systems
Two approaches to cell free protein synthesis:
Standard translation systems (reticulocyte and wheat extracts) use RNA as a template
Linked or coupled transcription+translation systems start with DNA templates Important elements for translation:
= Eukaryotic translation signal: 5’-GCCACCAUGG-3’ “Kozak”
sequence, if eukaryotic cell free translation system is used
= Prokaryotic translation signals: 5’-UAAGGAGGUGA-3’ Shine- Delgarno (SD) , if prokaryotic cell free translation system is used Linked system: tube 1.=transcription, tube 2.= translation.
= Each can be optimized separately.
Coupled system: both reactions in the same tube
Main steps of recombinant protein production
Identification/Isolation of gene of interest Cloning of gene into plasmid
Plasmid: expression vector Transformation into host cells
Growth of cells through fermentation
Plasmid: source of DNA template for transcription
In vitro transcription In vitro translation
In vivo Cell free
26
Escherichia coli/ Other bacteria Pichia pastoris/ Other yeast
Insect cell culture (Baculovirus) Mammalian cell culture
Plants
Sheep/cows/humans
(transgenics and gene therapy)
Recombinant protein expression in cells or organisms
Expression system selection
Choice depends on size and character of protein
Large proteins (>100 kD)? Choose eukaryote
Small proteins (<30 kD)? Choose prokaryote
High yields, low cost? Choose E. coli
Post-translational modifications essential? Choose yeast, baculovirus or other eukaryote
Glycosylation essential? Choose baculovirus or mammalian cell culture
28
Characteristics of (plasmid) vectors
1. Must be compatible with host cell system (prokaryotic vectors for prokaryotic cells, eukaryotic vectors for eukaryotic cells)
2. Features :
• strong promoter/inducible promoter
• transcription START sequences
• ribosome binding sites
• termination sequences, polyA signal sequence
• affinity tag or solubilization sequences
• multi-enzyme restriction site
• origin of replication (ORI)
• bacterial selectable marker (Amp or Tet)
• eukaryotic selectable marker
• recombination sequences
protein
expression
cloning, plasmid propagation
Promoter selection
• Constitutive - everywhere, all the time
• Tissue- or developmental stage-specific - selected cell types, specific timing
• Inducible - specific timing, can avoid toxicity to host
• Synthetic
30
Inducible promoters: Tet-off system
32
(faster response)
Inducible promoters: Tet-on
system
Steroid hormone induction: adenovirus promoter glucocorticoid response element inducer: dexamethasone
Tetracycline operon: CMV promoter
Tet operator sequence, Tet repressor protein inducer/repressor: tetracycline
Ecdyson-inducible system: requires two vectors SV40 promoter
human RXR receptor and Drosophila ecdyson receptor (VgEcR) = transcription factor heterodimer
Activator of transcription factor: pronasteroneA Nice dose response
Synthetic promoters, inducible systems
34
Bacterial expression systems
Grows quickly (8 hrs to produce protein)
High yields (50-500 mg/L)
Low cost of media (simple media constituents)
Low fermentor costs
Difficulty expressing large proteins (>50 kD)
No glycosylation or signal peptide removal
Eukaryotic proteins are sometimes toxic Can’t handle S-S rich proteins
Advantages Disadvantages
Promoter selection for prokaryotes
Promoter type Expression level Regulator/inducer Main characteristics
lac promoter low/middle IPTG Low level intracellular expression
trc and tac promoter moderatly high IPTG Higher expression
T7 RNA polymerase promoter very high IPTG Basal level depends on strain T7-lac system for tight control
High level induction
TetA promoter/operon middle/high tetracycline Low basal level
Tight regulation
Independent of metabolic state Phage promoter pL moderatly high temperature shift Very low basal level
Temperature sensitive host needed
PPBAD promoter low/high L-arabinose Very low basal level
Tight regulation
Fine-tuning, dose dependent
rhaPBAD promoter low/high L-rhamnose Very low basal level
Tight regulation
36
Cloning & transforming in yeast cells
Pichia pastoris
Saccharomyces cerevisiae
Pichia pastoris
Yeast are single celled eukaryotes
Behave like bacteria, but have key advantages of eukaryotes P. pastoris is a methylotrophic yeast that can use methanol as
its sole carbon source (using alcohol oxidase)
Has a very strong promoter for the alcohol oxidase (AOX) gene (~30% of protein produced when induced)
38
Grow quickly (8 hrs to produce protein)
Very high yields (50-5000 mg/L) Low cost of media (simple media constituents)
Low fermentor costs
Can express large proteins (>50 kD) Glycosylation & signal peptide removal Has chaperonins to help fold “tough”
prtns
Can handle S-S rich proteins
Advantages More advantages
Pichia pastoris cloning
Uses a special plasmid that works both in E. coli and yeast Once gene of interest is inserted into this plasmid, it must be
linearized
Transfect yeast cells with linear plasmid
Double cross-over recombination event occurs to cause the gene of interest to insert directly into P. pastoris chromosome
where the old AOX gene used to be
Now gene of interest is under control of the powerful AOX promoter
Stable transfectant
40
Cloning a gene into Pichia vector
systems
Bastiaan (Bart) Drees
Spodoptera f. larva Spodoptera frugiperda
Sf9 cells and
42
Baculoviru s
life cycle
1.
2.
3a.
3b.
4a.
4b.
Baculovirus life phases in culture
1. Early phase: cell entry, shutting down host gene expression viral protein synthesis
2. Late phase: viral DNS replication, virus assembly, release of viral particles from cell
(peak:18-36 hrs post-infection) Also used to prepare viral stock
3. Very late phase: polyhedrin and p10 genes are expressed, viruses embedded in polyhedrin form
occlusion bodies. Cell lysis.
(24-96 hrs post-infection)
44
Baculovirus mediated protein expression in insect cells
Autographica californica multiple nuclear polyhedrosis virus (Baculovirus) Virus commonly infects insects cells of the alfalfa looper (small beetle) or
armyworms (and their larvae)
Uses super-strong promoter from the polyhedrin coat protein to enhance
expression of proteins while virus resides inside the insect cell - protein is not required for infection or viral life cycle
Secreted proteins better expressed by stably transfected insect cell lines, from the ie-1 promoter
(infection interferes with secretory pathways)
Baculovirus expression system workflow
1. Cloning gene of interest into baculovirus genome
2. Use recombinant baculoviral DNA to transfect insect cells 3. Collect viral particles from insect cell culture supernatant 4. Test viral stock titer, freeze stocks
5. Infect new insect cell culture
6. Harvest cells (with occlusion bodies)
46
Cloning a gene into baculovirus (AcMNPV) vector
5’ 3’
Transfer vector
x x
Cloned gene
modified AcMNPV DNA,
“Bacmid” maintained in E. coli
5’ 3’
Cloned gene
Recombinant AcMNPV bacmid
Site-specific transposition
Gene of Interest
Tn7R polyhedrin promoter Gent+ Tn7L
Transfer vector with insert
Gene of Interest
Tn7 R
PpH Tn7 L
48
128bp 145bp
Mini att Tn7
M 13 forward M 13 reverse
Tn7R GOI Tn7L
Bacmid DNA
Transposition into bacmid
Baculovirus expression system
Grow very slowly (10-12 days for set- up)
Cell culture is only sustainable for 4-5 days
Set-up is time consuming, not as simple as yeast
Can express large proteins (>50 kD)
(Mostly) Correct glycosylation & signal peptide removal
Has chaperonins to help protein folding Very high yields, cheap
Disadvantages Advantages
50
Baculovirus successes
Alpha and beta interferon Adenosine deaminase
Erythropoietin Interleukin 2
Poliovirus proteins
Tissue plasminogen activator (TPA)
Mammalian expression systems
52
Mammalian expression systems
Selection takes time (weeks for set-up) Cell culture is only sustainable for limited period of time
Set-up is very time consuming, costly, modest yields
Can express large proteins (>50 kD) Correct glycosylation & signal peptide removal, generates authentic proteins Has chaperonins to help protein folding
Disadvantages Advantages
Mammalian expression system
Gene initially cloned into plasmid, and propagated in bacterial cells
Cells are typically derived from the Chinese Hamster Ovary (CHO) cell line Mammalian cells transformed by electroporation (with linear plasmid) and
gene integrates (1 or more times) into random locations within different CHO chromosomes
Multiple rounds of growth and selection using methotrexate to select for those cells with highest expression & integration of DHFR and the gene of interest Stably transfected cell lines are generated - long term culturing
54
Characteristics of mammalian expression vectors
Recombinant gene expression requires multiple elements in the vector:
• promoter (general or tissue-specific)
• enhancer
• polyA signal
• intron - may enhance expression
• selection marker (ampicylin, neomycin, DHFR etc.)
• Frequently used promoters: simian virus 40 (SV40) (strong promoters) papovavirus
Rous sarcoma virus
human cytomegalovirus (CMV)
Methotrexate (MTX) selection
Gene of interest DHFR
Transfect
DHFR minus cells
Grow in nucleoside free medium
Culture a colony of cells
Grow in 0.05 uM Mtx
Culture a colony of cells
56
Grow in 0.25 uM Mtx
Grow in 0.5 uM Mtx Culture a
Colony of cells
Culture a Colony of cells
Foreign gene expressed at high level in CHO cells
Methotrexate (MTX) selection
Multiple rounds of selection, increasing MTX concentration
Mammalian cell successes
Factor IX Factor VIII
Gamma interferon Interleukin 2
Human growth hormone
Tissue plasminogen activator (TPA)
58
Purification of recombinant proteins
Application Required Purity
Therapeutic use, in vivo studies Extremely high > 99%
Biochemical assays, X-ray
crystallography High 95-99%
N-terminal sequencing, antigen for
antibody production, NMR Moderately high < 95%
Purification of recombinant proteins
Size
Hydro-
phobicity
Charge
Activity
BEHAVIOUR
60
Conventional purification strategy
• Use different properties of protein in purification scheme
• Multiple intermediate steps may be required
• Need to detect low amounts
Affinity-tag based purification strategy
• Fusion proteins with affinity tag
• Tag: peptide or protein
• Tag binds something very selectively and w. high
affinity
• Very effective purification in initial step
• Tag can be used for detection
• Tag can be cleaved off
62
gene for protein of interest insert affinity tag sequence introduce into cells
Tagged protein
Purification of tagged protein Immunolocalization of protein
Other interacting proteins
Affinity-tagging of recombinant proteins
Solid matrix
Nickel ion (Ni2+) Poly-histidine
on protein
His-Ni2+ stable complex at near-neutral aqueous conditions
Histidine tag
64
Making proteins bind nickel
His-tag based purification strategy
66
Examples for affinity and epitope tags
His-tag: N-or C-terminal 6xHistidin, binds to Ni-resin
• purification
T7-tag: starting sequence for T7 gene (11 amino acids)
• enhancer for translation
S-tag: ribonuclease A S-peptid (15 amino acids)
• detection, isolation: biotinylated S-protein, S-protein affinity Strep-tag: C-terminal AWRHPQFGG sequence (affinity to streptavidin) purification
Epitope-tags: recognised by good antibodies (usually monoclonal)
• FLAG-tag (NYKNNNNK)
• c-myc-tag (QGKLISGGNL)
TAP-tag: „tandem-affinity purification”, calmodulin-binding protein and protein A both fused to protein of interest
• very good system to study protein-protein interactions
Fusion proteins in prokaryotic expression systems
Proteins expressed in E. coli are often produced as fusion proteins:
• function of the protein in bacteria is not of interest
• mammalian protein is not expressed effectively by itself
• bacterial fusion partner, (e.g. GST) on the other hand, is expressed effectively – fusion protein is likely to be expressed well, too
• one-step purification from bacterial lysate
68
Bacterial fusion protein systems
Glutathion-S-transferase: 26 kDa protein
Schistosoma japonica gene product pGEX vector-series
fast isolation on glutathion-resin
Maltose-binding protein: E. coli malE gene product pMEL vector-series
solation on maltose affinity column
Thioredoxin 17 kDa protein, heat-stable, very good solubility
Ribonucleotide-reductase reducing enzyme E. coli trxA gene product
pTrxFus vector
Glutathione-S-transferase fusion protein expression system
pGEX
Lac inhibitor
gene Ampicyllin resistance
gene Lac promoter
GST
Polylinker or Multicloning site
Repressor protein
IPTG
70
Which tag to use?
Specificity of binding interaction Cost of resin
Native vs. denaturing elution Presence of metals
Expression level, solubility & toxicity of target protein Tag removal
Tag removal
NH2– tag linker protein
DDDDK
Linker/cleavage strategy selection:
• effect on structure
• effect on function
• flexibility
• protein 1° sequence
• removal of protease
72
Excision Site Cleavage Enzyme Comment
D-D-D-D-KX enterokinase active: pH 4.5-9.5, 4-45°C X cannot be P
secondary cleavage sites
I-D/E-G-RX factor Xa protease X cannot be P/R secondary cleavage sites
L-V-P-RG-S thrombin biotynilated form available secondary cleavage sites
E-N-L-Y-F-QG TEV protease active: wide range of T His-tagged form available
L-E-V-L-F-QG-P PreScissionTM protease
engineered with GST tag
Tag removal
crude
His-resin I
tag cleavage
His-resin II
gel filtration
Pure protein
Purification protocol : as few steps as possible
• His-resin I usually provides a major step of the purification
• His-resin II removes cleaved-off His-tag and persistent contaminant proteins in E.coli host
• Gel-filtration – “polishing”