at the University of Pécs and at the University of Debrecen Identification number

Teljes szövegt

(1)

in the Teaching Material of

Medical Biotechnology Master’s Programmes

at the University of Pécs and at the University of Debrecen

Identification number: TÁMOP-4.1.2-08/1/A-2009-0011

(2)

RECOMBINANT PROTEINS

Beáta Scholtz

Molecular Therapies- Lecture 3

Medical Biotechnology Master’s Programmes

at the University of Pécs and at the University of Debrecen

Identification number: TÁMOP-4.1.2-08/1/A-2009-0011

(3)

1.1 OVERVIEW: PROTEIN PHARMACEUTICALS

1.2 CELL-FREE SYSTEMS: IN VITRO TRANSCRIPTION AND TRANSLATION 1.3 EXPRESSION OF RECOMBINANT PROTEINS IN CELL CULTURE

1.4 NON-PROKARYOTIC EXPRESSION SYSTEMS 1.4.1 Pichia pastoris

1.4.2 Protein expression in insect cells 1.4.3 Mammalian expression systems

1.5 PURIFICATION OF RECOMBINANT PROTEINS

RECOMBINANT PROTEINS

The aim of this lecture is to describe the in vitro and in vivo systems utilized for

expression of recombinant proteins, and discuss the advantages and disadvantages of these systems. We will also discuss the basics of affinity-tag based protein

purification.

(4)

4

Pure protein preparations

Uses: medicine and research Sources:

• natural protein mixtures - human/animal/fungi/plant

• artificial preparations - synthetic peptides, recombinant proteins

Insulin Pigs or cattle (pancreas)

Factor VIII Human blood (donated)

Human growth hormone Human brains

Calcitonin Salmon

Anti-venom Horse or goat blood

Protein pharmaceutical Natural Source

(5)

5

Equipment used for blood fractionation

(6)

6

B. Rogge Box jellyfish,

Australia

Lonomia caterpillar, Brasil

R. Morante

Black scorpion, Arabia P-A. Olsson

(7)

7

Protein pharmaceuticals

Natural sources are often rare and expensive Difficult to keep up with demand

Hard to isolate product

May lead to immune reactions (diff. species) Viral & pathogen contamination

Most protein pharmaceuticals today are produced recombinantly

Cheaper, safer, abundant supply

(8)

8

Peptide drugs

Many hormones are actually small peptides (2-40 amino acids) Calcitonin (32 residues)

Thyroid hormone to enhance bone mass Oxytocin (9 residues)

Pituitary hormone to stimulate labor Vasopressin (9 residues)

Pituitary hormone for antidiuretic/vasoconstriction

(9)

9

Peptide drugs

Small enough to synthesize using solid phase chemistry (SPPS) Method developed by Bruce Merrifield in 1960’s (won Nobel

prize)

Very efficient synthesis (>99%/couple) Still: 50 residue peptide, 99% coupling

Yield = 0.9950 = 60.5%

Technique limited to small peptides

(10)

10

Recombinant proteins

Developed in 1970’s &1980’s

Paul Berg (1973) restriction enzymes

Herbert Boyer (1978) cloning human insulin into E. coli – Genentech

Four general approaches

 Expression in cell-free systems

 Expression in isolated cells

 Expression in transgenic plants/animals

 Gene therapy in humans

(11)

11

Cell-free systems:

In vitro transcription and translation

• Rapid identification of gene products

• Functional analyses

• Analyze protein-protein interactions

• Study protein folding

• Incorporate modified amino acids for functional studies

• Engineer truncated gene products

(12)

12

Advantages over in vivo gene expression:

When the protein is:

toxic to the host cell

insoluble or forms inclusion bodies

degraded rapidly by intracellular proteases Speed and directness of all procedures

Absence of constraints from a living cell Pure product

Disadvantages over in vivo gene expression:

Lack of cellular membranes

Lack of post translational modifications

Cell-free systems:

In vitro transcription and translation

(13)

13

Components for in vitro transcription

• Linearized DNA template

• Phage RNA polymerase

• 4dNTP

• Buffer

1998 by Alberts, Bray, Johnson, Lewis, Raff, Roberts, Walter.

Published by Garland Publishing.

In vivo In vitro

(14)

14

Phage RNA polymerases

Phage Polymerase Host of Phage Promoter Sequence

T7 RNA polymerase E. coli 5’TAATACGACTCACTATAGGG 3’

T3 RNA polymerase E. coli 5’AAATTAACCCTCACTAAAGGG3’

SP6 RNA polymerase Salmonella

typhimurium 5’AATTTAGGTGACACTATAGAA3’

(15)

15

Characteristics of RNA polymerases

RNA polymerases proceed at a much slower rate than DNA polymerases.

RNA pol (50-100 bases/sec) DNA pol (1000 bases/sec)

The fidelity of RNA synthesis is much lower than that of DNA.

RNA polymerases do not contain proofreading mechanisms.

(16)

16

DNA template

Plasmids

Many commonly used cloning vectors contain phage polymerase promoters outside of the multiple cloning site.

PCR Products Primer must

contain promoter Oligonucleotides

(17)

17

Linearization of template

• Plasmids: no RNA polymerase termination signal; templates are linearized

• PCR template: termination signal in the amplified region OR in the primer

(18)

18

Translation in eukaryotic cells

1998 by Alberts et al.

Published by Garland Publishing.

(19)

19

• tRNA & aminoacyl-tRNA synthetases

• Ribosomes

• Amino acids

• ATP, GTP

• Initiation, elongation, and termination factors

• Buffer

• RNA template

Components for in vitro translation

Much more complex than transcription

Cannot be mixed from a few isolated components Always provided as crude extract of cells

(20)

20

Common in vitro translation systems

Rabbit reticulocyte lysate Wheat germ extract

E. coli extract

(21)

21

Rabbit reticulocyte lysates

Reticulocytes:

immature red blood cells no nuclei (DNA)

complete translation machinery, for extensive globin synthesis

Endogenous globin mRNA can be eliminated by incubation with a Ca2+dependent micrococcal nuclease. The nuclease is later inactivated by EGTA.

Low background

Efficient utilization of exogenous RNAs, even at low concentrations Low nuclease activity

Capable of synthesizing large amounts of full-length products Capable of translating either capped or uncapped RNAs

(22)

22

Wheat germ lysates

Low background incorporation due to low levels of endogenous mRNA

Recommended for translation of RNA containing small fragments of double-

stranded RNA or oxidized thiols, which are inhibitory to the rabbit reticulocyte lysate

Generally more cap dependent than reticulocyte systems

Often preferable when synthesizing relatively small proteins (12-15kDa) that comigrate with globin, which is abundant in reticulocyte extracts

(23)

23

E. coli lysates

Simple translational apparatus and less complicated initiation control mechanisms

BUT: bacterial extracts contain nucleases that rapidly degrade most exogenous RNAs

Extract must be incubated during preparation so that excess endogenous mRNA is translated and subsequently

degraded

The exogenous product is easily identifiable

(24)

24

Two approaches to cell free protein synthesis:

Standard translation systems (reticulocyte and wheat extracts) use RNA as a template

Linked or coupled transcription+translation systems start with DNA templates

Important elements for translation:

= Eukaryotic translation signal: 5’-GCCACCAUGG-3’ “Kozak”

sequence, if eukaryotic cell free translation system is used

= Prokaryotic translation signals: 5’-UAAGGAGGUGA-3’ Shine- Delgarno (SD) , if prokaryotic cell free translation system is used Linked system: tube 1.=transcription, tube 2.= translation.

= Each can be optimized separately.

Coupled system: both reactions in the same tube

(25)

25

Main steps of recombinant protein production

Identification/Isolation of gene of interest Cloning of gene into plasmid

Plasmid: expression vector Transformation into host cells

Growth of cells through fermentation

Plasmid: source of DNA template for transcription

In vitro transcription In vitro translation

Isolation & purification of protein

In vivo Cell free

Formulation of protein product Research

(26)

26

Escherichia coli/ Other bacteria Pichia pastoris/ Other yeast

Insect cell culture (Baculovirus) Mammalian cell culture

Plants

Sheep/cows/humans

(transgenics and gene therapy)

Recombinant protein expression in cells or organisms

(27)

27

Expression system selection

Choice depends on size and character of protein

 Large proteins (>100 kD)? Choose eukaryote

 Small proteins (<30 kD)? Choose prokaryote

 High yields, low cost? Choose E. coli

 Post-translational modifications essential? Choose yeast, baculovirus or other eukaryote

 Glycosylation essential? Choose baculovirus or mammalian cell culture

(28)

28

Characteristics of (plasmid) vectors

1. Must be compatible with host cell system (prokaryotic vectors for prokaryotic cells, eukaryotic vectors for eukaryotic cells)

2. Features :

• strong promoter/inducible promoter

• transcription START sequences

• ribosome binding sites

• termination sequences, polyA signal sequence

• affinity tag or solubilization sequences

• multi-enzyme restriction site

• origin of replication (ORI)

• bacterial selectable marker (Amp or Tet)

• eukaryotic selectable marker

• recombination sequences

protein

expression

cloning, plasmid propagation

(29)

29

Promoter selection

• Constitutive - everywhere, all the time

• Tissue- or developmental stage-specific - selected cell types, specific timing

• Inducible - specific timing,

can avoid toxicity to host

• Synthetic

(30)

30

(31)

31

Inducible promoters: Tet-off system

(32)

32

(faster response)

Inducible promoters: Tet-on

system

(33)

33 Steroid hormone induction: adenovirus promoter

glucocorticoid response element inducer: dexamethasone

Tetracycline operon: CMV promoter

Tet operator sequence, Tet repressor protein inducer/repressor: tetracycline

Ecdyson-inducible system: requires two vectors SV40 promoter

human RXR receptor and Drosophila ecdyson receptor (VgEcR) = transcription factor heterodimer

Activator of transcription factor: pronasteroneA Nice dose response

Synthetic promoters, inducible systems

(34)

34

Bacterial expression systems

Grows quickly (8 hrs to produce protein)

High yields (50-500 mg/L)

Low cost of media (simple media constituents)

Low fermentor costs

Difficulty expressing large proteins (>50 kD)

No glycosylation or signal peptide removal

Eukaryotic proteins are sometimes toxic Can’t handle S-S rich proteins

Advantages Disadvantages

(35)

35

Promoter selection for prokaryotes

Promoter type Expression level Regulator/inducer Main characteristics

lac promoter low/middle IPTG Low level intracellular expression

trc and tac promoter moderatly high IPTG Higher expression

T7 RNA polymerase promoter very high IPTG Basal level depends on strain

T7-lac system for tight control High level induction

TetA promoter/operon middle/high tetracycline Low basal level

Tight regulation Independent of metabolic state

Phage promoter pL moderatly high temperature shift Very low basal level

Temperature sensitive host needed

PPBAD promoter low/high L-arabinose Very low basal level

Tight regulation Fine-tuning, dose dependent

rhaPBAD promoter low/high L-rhamnose Very low basal level

Tight regulation

(36)

36

Cloning & transforming in yeast cells

Pichia pastoris

Saccharomyces cerevisiae

(37)

37

Pichia pastoris

Yeast are single celled eukaryotes

Behave like bacteria, but have key advantages of eukaryotes

P. pastoris is a methylotrophic yeast that can use methanol as its sole carbon source (using alcohol oxidase)

Has a very strong promoter for the alcohol oxidase (AOX) gene (~30% of protein produced when induced)

(38)

38

Grow quickly (8 hrs to produce protein)

Very high yields (50-5000 mg/L) Low cost of media (simple media constituents)

Low fermentor costs

Can express large proteins (>50 kD) Glycosylation & signal peptide removal Has chaperonins to help fold “tough”

prtns

Can handle S-S rich proteins

Advantages More advantages

(39)

39

Pichia pastoris cloning

Uses a special plasmid that works both in E. coli and yeast Once gene of interest is inserted into this plasmid, it must be

linearized

Transfect yeast cells with linear plasmid

Double cross-over recombination event occurs to cause the gene of interest to insert directly into P. pastoris chromosome where the old AOX gene used to be

Now gene of interest is under control of the powerful AOX promoter

Stable transfectant

(40)

40

(41)

41

Baculovirus/insect cell expression systems

Bastiaan (Bart) Drees

Spodoptera f. larva Spodoptera frugiperda

Sf9 cells and baculovirus

(42)

42

Baculovirus life cycle

1.

2.

3a.

3b.

4a.

4b.

(43)

43

Baculovirus life phases in culture

1. Early phase: cell entry, shutting down host gene expression viral protein synthesis

2. Late phase: viral DNS replication, virus assembly, release of viral particles from cell

(peak:18-36 hrs post-infection) Also used to prepare viral stock

3. Very late phase: polyhedrin and p10 genes are expressed, viruses embedded in polyhedrin form occlusion bodies. Cell lysis.

(24-96 hrs post-infection) Used for protein production

(44)

44

Baculovirus mediated protein expression in insect cells

Autographica californica multiple nuclear polyhedrosis virus (Baculovirus)

Virus commonly infects insects cells of the alfalfa looper (small beetle) or armyworms (and their larvae)

Uses super-strong promoter from the polyhedrin coat protein to enhance

expression of proteins while virus resides inside the insect cell - protein is not required for infection or viral life cycle

Secreted proteins better expressed by stably transfected insect cell lines, from the ie-1 promoter

(infection interferes with secretory pathways)

(45)

45

Baculovirus expression system workflow

1. Cloning gene of interest into baculovirus genome

2. Use recombinant baculoviral DNA to transfect insect cells 3. Collect viral particles from insect cell culture supernatant 4. Test viral stock titer, freeze stocks

5. Infect new insect cell culture

6. Harvest cells (with occlusion bodies)

Note: not a stable cell line!

(46)

46

Cloning a gene into baculovirus (AcMNPV) vector

5’ 3’

Transfer vector

x x

Cloned gene

modified AcMNPV DNA,

“Bacmid” maintained in E. coli

5’ 3’

Cloned gene

Recombinant AcMNPV bacmid

Site-specific transposition

(47)

47 Gene of Interest

Tn7R polyhedrin promoter Gent+ Tn7L

Transfer vector with insert

Gene of Interest

Tn7 R

PpH Tn7 L

Bacmid with insert

(48)

48

128bp 145bp

Mini att Tn7

M 13 forward M 13 reverse

Tn7R GOI Tn7L

Bacmid DNA

Transposition into bacmid

(49)

49

Baculovirus expression system

Grow very slowly (10-12 days for set- up)

Cell culture is only sustainable for 4-5 days

Set-up is time consuming, not as simple as yeast

Can express large proteins (>50 kD) (Mostly) Correct glycosylation & signal peptide removal

Has chaperonins to help protein folding Very high yields, cheap

Disadvantages Advantages

(50)

50

Baculovirus successes

Alpha and beta interferon Adenosine deaminase

Erythropoietin Interleukin 2

Poliovirus proteins

Tissue plasminogen activator (TPA)

(51)

51

Mammalian expression systems

(52)

52

Mammalian expression systems

Selection takes time (weeks for set-up) Cell culture is only sustainable for

limited period of time

Set-up is very time consuming, costly, modest yields

Can express large proteins (>50 kD) Correct glycosylation & signal peptide removal, generates authentic proteins Has chaperonins to help protein folding

Disadvantages Advantages

(53)

53

Mammalian expression system

Gene initially cloned into plasmid, and propagated in bacterial cells

Cells are typically derived from the Chinese Hamster Ovary (CHO) cell line

Mammalian cells transformed by electroporation (with linear plasmid) and gene integrates (1 or more times) into random locations within different CHO

chromosomes

Multiple rounds of growth and selection using methotrexate to select for those cells with highest expression & integration of DHFR and the gene of interest

Stably transfected cell lines are generated - long term culturing

(54)

54

Characteristics of mammalian expression vectors

Recombinant gene expression requires multiple elements in the vector:

• promoter (general or tissue-specific)

• enhancer

• polyA signal

• intron - may enhance expression

• selection marker (ampicylin, neomycin, DHFR etc.)

• Frequently used promoters: simian virus 40 (SV40) (strong promoters) papovavirus

Rous sarcoma virus

human cytomegalovirus (CMV)

(55)

55

Methotrexate (MTX) selection

Gene of interest DHFR

Transfect

DHFR minus cells

Grow in nucleoside free medium

Culture a colony of cells

Grow in 0.05 uM Mtx

Culture a colony of cells

(56)

56

Grow in 0.25 uM Mtx

Grow in 0.5 uM Mtx Culture a

Colony of cells

Culture a Colony of cells

Foreign gene expressed at high level in CHO cells

Methotrexate (MTX) selection

Multiple rounds of selection, increasing MTX concentration

(57)

57

Mammalian cell successes

Factor IX Factor VIII

Gamma interferon Interleukin 2

Human growth hormone

Tissue plasminogen activator (TPA)

(58)

58

Purification of recombinant proteins

Application Required Purity

Therapeutic use, in vivo studies Extremely high > 99%

Biochemical assays, X-ray

crystallography High 95-99%

N-terminal sequencing, antigen for

antibody production, NMR Moderately high < 95%

(59)

59

Purification of recombinant proteins

All proteins are different

Size

Hydro-

phobicity

Charge

Activity

BEHAVIOUR

(60)

60

Conventional purification strategy

• Use different properties of protein in purification scheme

• Multiple intermediate steps may be required

• Need to detect low amounts

(61)

61

Affinity-tag based purification strategy

• Fusion proteins with affinity tag

• Tag: peptide or protein

• Tag binds something very selectively and w. high

affinity

• Very effective purification in initial step

• Tag can be used for detection

• Tag can be cleaved off

(62)

62

gene for protein of interest insert affinity tag sequence introduce into cells

Tagged protein

Purification of tagged protein

Immunolocalization of protein

Other interacting proteins

Affinity-tagging of recombinant proteins

(63)

63

Solid matrix

Nickel ion (Ni2+) Poly-histidine

on protein

His-Ni2+ stable complex at near-neutral aqueous conditions

Histidine tag

(64)

64

Making proteins bind nickel

(65)

65

His-tag based purification strategy

(66)

66

Examples for affinity and epitope tags

His-tag: N-or C-terminal 6xHistidin, binds to Ni-resin

• purification

T7-tag: starting sequence for T7 gene (11 amino acids)

• enhancer for translation

S-tag: ribonuclease A S-peptid (15 amino acids)

• detection, isolation: biotinylated S-protein, S-protein affinity

Strep-tag: C-terminal AWRHPQFGG sequence (affinity to streptavidin) purification

Epitope-tags: recognised by good antibodies (usually monoclonal)

• FLAG-tag (NYKNNNNK)

• c-myc-tag (QGKLISGGNL)

TAP-tag: „tandem-affinity purification”, calmodulin-binding protein and protein A both fused to protein of interest

• very good system to study protein-protein interactions

(67)

67

Fusion proteins in prokaryotic expression systems

Proteins expressed in E. coli are often produced as fusion proteins:

• function of the protein in bacteria is not of interest

• mammalian protein is not expressed effectively by itself

• bacterial fusion partner, (e.g. GST) on the other hand, is expressed effectively – fusion protein is likely to be expressed well, too

• one-step purification from bacterial lysate

(68)

68

Bacterial fusion protein systems

Glutathion-S-transferase: 26 kDa protein

Schistosoma japonica gene product pGEX vector-series

fast isolation on glutathion-resin

Maltose-binding protein: E. coli malE gene product pMEL vector-series

solation on maltose affinity column

Thioredoxin 17 kDa protein, heat-stable, very good solubility

Ribonucleotide-reductase reducing enzyme E. coli trxA gene product

pTrxFus vector

(69)

69

Glutathione-S-transferase fusion protein expression system

pGEX

Lac inhibitor gene

Ampicyllin resistance gene

Lac promoter

GST

Polylinker or Multicloning site

Ori

Repressor protein

IPTG

(70)

70

Which tag to use?

Specificity of binding interaction Cost of resin

Native vs. denaturing elution Presence of metals

Expression level, solubility & toxicity of target protein Tag removal

(71)

71

Tag removal

NH2tag linker protein

DDDDK

protease

Linker/cleavage strategy selection:

• effect on structure

• effect on function

• flexibility

• protein 1° sequence

• removal of protease

(72)

72

Excision Site Cleavage Enzyme Comment

D-D-D-D-KX enterokinase active: pH 4.5-9.5, 4-45°C X cannot be P

secondary cleavage sites

I-D/E-G-RX factor Xa protease X cannot be P/R secondary cleavage sites

L-V-P-RG-S thrombin biotynilated form available secondary cleavage sites

E-N-L-Y-F-QG TEV protease active: wide range of T His-tagged form available

L-E-V-L-F-QG-P PreScissionTM protease

engineered with GST tag

Tag removal

(73)

73

crude

His-resin I

tag cleavage

His-resin II

gel filtration

Pure protein

Purification protocol : as few steps as possible

• His-resin I usually provides a major step of the purification

• His-resin II removes cleaved-off His-tag and persistent contaminant proteins in E.coli host

• Gel-filtration – “polishing”

Ábra

Updating...

Hivatkozások

Updating...

Kapcsolódó témák :