Lung cancer

Top PDF Lung cancer:

Effect of the Hedgehog Pathway inhibitor GDC-0449 in lung cancer cells and lung cancer stem cells

Effect of the Hedgehog Pathway inhibitor GDC-0449 in lung cancer cells and lung cancer stem cells

Worldwide, lung cancer is the most common cancer in terms of both incidence and mortality with the highest rates in Europe and North America. First-line chemotherapy often leads to encouraging responses in lung cancer, but during the treatment process, resistance to the chemotherapy frequently occurs and ultimately limits the life expectancy of the patient. The existence of CSC is an possible explanation for this phenomenon. Since CSCs are chemo- resistant, they survive the chemotherapy and reestablish the tumor burden afterwards. A better understanding of the CSC mechanism is required, which includes the generation of CSC, the functional evidences of CSC to proliferate the cancer bulk and the escape mechanism of CSC from conventional cancer therapy. The cancer specific markers for CSCs need to be found and methods to detect CSCs in vivo need to be established, in order to use the CSC status in cancer as one indicate for the relapse possibility and one index for therapy effectiveness. Therefore, the incorporation of anti-CSC component into the therapeutic regiments casts light into the cancer therapy field. A new therapy strategy could be to combine the chemotherapy medication, which executes the tumor bulk, with the anti-CSC component as GDC-0449, which prevents CSCs from proliferating cancer cells after the withdrawing of chemotherapy. As GDC-0449 has not yet been evaluated in lung cancer, although it has entered clinical trials in several other cancers and showed promising effect, our findings support the further clinical usage of GDC-0449 in lung cancer and GDC-0449 used alone or combined with other
Mehr anzeigen

104 Mehr lesen

Schedule-dependent interactions between pemetrexed and vinorelbine in human lung cancer cells

Schedule-dependent interactions between pemetrexed and vinorelbine in human lung cancer cells

Lung cancer is the leading cause of cancer deaths worldwide. The two major forms of lung cancer are non–small cell lung cancer (NSCLC, about 85% of all lung cancers) and small-cell lung cancer (SCLC, about 15%) [1]. Lung cancer causes more deaths than the next three most common cancers combined (colon, breast and prostate), accounting for approximately 28% of all cancer deaths [2]. The lung cancer five-year survival rate (16.3%) is lower than many other leading cancer sites, such as the colon (65.2%), breast (90.0%) and prostate (99.9%), which accounts 52.6% for cases detected when the disease is still localized however only 15% of lung cancer cases are diagnosed at an early stage [3]. For distant tumors the five-year survival rate is only 3.5% and over half of people with lung cancer die within one year of being diagnosed [4].
Mehr anzeigen

60 Mehr lesen

Neutrophillymphocyte ratio is prognostic in early stage resected small-cell lung cancer

Neutrophillymphocyte ratio is prognostic in early stage resected small-cell lung cancer

Small cell lung cancer (SCLC) is a highly aggressive malignancy with a poor prognosis ( Siegel, Miller & Jemal, 2017 ). In most cases it is diagnosed in advanced-stages, therefore surgical resection is rarely possible and serves little clinical benefit ( Lad et al., 1994 ). In recent years, for selected early stage cases, curative intent surgery has been offered, however there remains no validated predictive or prognostic biomarker for these patients. Two large cohort study suggests an increased role of surgery in multimodality therapy for early stage SCLC ( Combs et al., 2015 ; Yang et al., 2017 ). These results might indicate that surgery could be a treatment option even in locally-advanced disease after appropriate patient selection.
Mehr anzeigen

18 Mehr lesen

Prostate specific membrane antigen (PSMA) expression in non-small cell lung cancer

Prostate specific membrane antigen (PSMA) expression in non-small cell lung cancer

The fact that patients are often diagnosed with late-stage and/or metastatic disease contributes to the high mortality of lung cancer patients. Since lung cancer is the most frequent cause of cancer-related death, it is necessary to improve both our diagnostic and our therapeutic arma- mentarium to overcome its high lethality and its poor prognosis[ 1 ]. PSMA (prostate-specific membrane antigen) is a type II transmembrane glycoprotein with influence on the activity of folate hydrolase and neurocarboxypeptidase[ 2 , 3 ]. Initially, upregulation of PSMA was found in prostate cancer cells. Consequently, PSMA-based imaging technologies for the detection of metastatic disease in advanced-stage prostate cancer patients were developed and PSMA- based radioligand therapy was introduced as a therapeutic regimen in metastasized prostate cancer[ 3 – 10 ].
Mehr anzeigen

12 Mehr lesen

Epigenetic silencing of downstream genes mediated by tandem orientation in lung cancer

Epigenetic silencing of downstream genes mediated by tandem orientation in lung cancer

and cloned in a novel BsiWI site 3′ of EGFP (generated by in vitro mutagenesis with primer BsiwIMutU1: 5′-AGGCAGGATCTCGAGATCTGAGCGTACGCTTGTACAGCTCGTCCATGCCG and the reverse Figure 6. Epigenetic regulation of tandem genes in lung cancer. (A) Outline of the tandem oriented reporter gene construct analyzed by chromatin immuno-precipitation (ChIP). The analyzed TO/EGFP and RASSF1A/ RLuc promoter regions are depicted. For details see Fig.  5 . (B) TREx293 cells stably transfected with TO- EGFP-2.3-RLuc (clone B7) were induced with 4 mM Dox (+) or uninduced (−) for four days (d) and histone modifications were analyzed by ChIP. Chromatin was precipitated with anti histone H3K9ac, histone H4ac and IgG antibodies (negative control) antibodies. DNA was isolated and analyzed by qPCR. Levels are plotted relative to 1% of input sample. (C) Expression of HDAC1, HDAC2, HDAC5, HDAC6, DNMT1, DNMT3A,
Mehr anzeigen

14 Mehr lesen

Radiation-Induced Activation of the Epidermal Growth Factor Receptor in Lung Cancer

Radiation-Induced Activation of the Epidermal Growth Factor Receptor in Lung Cancer

Lung cancer is the leading cause of cancer deaths worldwide, having a great impact on personal and socioeconomic health. Current treatment regimes still leave a great percentage of patients with a poor outcome. To improve the outcome of patients by increasing the efficacy of radiation therapy, which represents a major component of cancer treatment, especially in late stage disease, new treatment strategies such as inhibition of the epidermal growth factor receptor (EGFR) are currently in development (Ansari et al., 2009; Sangha et al., 2009). While the EGFR inhibition is a promising strategy, not all patients are expected to benefit from a supporting inhibitory therapy in addition to irradiation. This indicates the need for predictive markers that can be evaluated for each cancer patient to initiate EGFR inhibitory treatment only in those for whom it will be beneficial. To study the value of a KRAS mutation in NSCLC cell lines as a predictive marker for response to a combined treatment with the tyrosine kinase inhibitor (TKI) erlotinib and irradiation, the presented experiments were conducted.
Mehr anzeigen

72 Mehr lesen

Immunotherapy for Non Small Cell Lung Cancer / written by Sabrina Lummerstorfer

Immunotherapy for Non Small Cell Lung Cancer / written by Sabrina Lummerstorfer

Further investigations are required to establish the histological type of lung cancer but also to evaluate the staging of cancer and its spreading. The most common imaging methods are X-ray and computer tomography (CT) but sometimes additional methods like ultrasonography, magnet resonance imaging (MRI), radionuclide bone scanning or positron emission tomography (PET) are required. Method of choice for the determination of histological subtype is transthoracic needle aspiration, also called a biopsy, but further methods are sputum cytology (non-invasive, low sensitivity), bronchoscopy, mediastinoscopy or endobronchial and endoscopic ultrasound. Lung cancers quite often show mutations and some of these mutations are used for therapeutic purpose. Therefore, some of these mutations are tested within histology for optimal treatment planning.
Mehr anzeigen

61 Mehr lesen

Development of novel nanoparticle-based therapeutics for treatment of lung cancer

Development of novel nanoparticle-based therapeutics for treatment of lung cancer

Cisplatin is a commonly used chemotherapeutic agent for treatment of several solid cancers, including lung cancer (Adelstein and Rodriguez, 2008). Drawbacks of cisplatin therapy include nephrotoxicity, nausea, hair loss, and acquired resistance of tumors towards the treatment. A more targeted and local delivery of cisplatin may result in lower administrated therapeutic doses, and consequently reduced systemic toxicity. For these reasons, we decided to use cisplatin as one of the chemotherapeutic loads in our MSNs. Accordingly, cisplatin release from the particles was measured as a function of cell viability. In both cell lines, cells exposed to particles (cMSN AVI ) loaded with cisplatin in the absence of MMP9 showed only minor loss of cell viability, compared to untreated control cells (white bars in Figures 5.6A&B). These results clearly demonstrate the tight sealing of the cisplatin loaded MSNs by the avidin capping. Strikingly, in both cell lines the cytotoxic effects of cisplatin were dependent on both the release from the particles by MMP9 and the cisplatin encapsulated dose (Figures 5.6A&B). Significant cell death was already observed for cells exposed to particles loaded with a 10 μM solution of cisplatin when 1 μg/mL MMP9 was administered into the medium, and to a similar extent in cells exposed to particles loaded with a 20 μM solution of cisplatin in the presence of 0.5 μg/ml MMP9. H1299 cells were more sensitive towards the cisplatin loaded MSNs, in analogy to the calcein-AM release experiments. As a control, we exposed A549 and H1299 cells to the non-cleavable linker bearing ncMSN AVI particles loaded with cisplatin. Our data showed that even in the presence of 1 µg/mL recombinant MMP9, no significant cell death was observed in A549 and H1299 cell lines, proving that the cleavable linker was indeed MMP9-specific, and this specificity was lost in the non-cleavable linker bearing ncMSN AVI system (Figure 5.6C).
Mehr anzeigen

134 Mehr lesen

Validation of CCR2-targeted mesoporous silica nanoparticles for lung cancer therapy

Validation of CCR2-targeted mesoporous silica nanoparticles for lung cancer therapy

Introduction micelles and gold-silica nanoparticles (Bolukbas & Meiners, 2015; Landesman- Milo, Ramishetti, & Peer, 2015). Especially lipid based carrier systems have been developed, as they can encapsulate the drugs easily, are biocompatible and can be modified on their surfaces (Landesman-Milo et al., 2015). However, their low bio-stability and rapid renal clearance can be a problem (Yang & Yu, 2016). So far lung cancer therapeutics have been delivered through intravenous or oral application. Another approach can be inhalation therapies as the local admin- istration of the drug can potentially reduce side effects, decrease biodegradation and enhance cell-specific targeting. However, so far there are predominantly pre- clinical studies with antibody and cytotoxic drug delivery via inhalation, as con- cerns about occupational exposure, systemic effects and total lung toxicity have been raised (Abdelaziz et al., 2018; Kuzmov & Minko, 2015). In addition, local pulmonary clearance and lung specific side effects, such as high lung toxicity, impede inhalative approaches from entering clinical practice. Nonetheless, there is still a lack of clinical studies with inhalable nanoparticle formulations. As of yet only, a few lipid based approaches have been tested (Abdelaziz et al., 2018).
Mehr anzeigen

89 Mehr lesen

The role of lamin B1 in lung cancer development and metastasis

The role of lamin B1 in lung cancer development and metastasis

In addition, we observed a more profound upregulation of RET upon EZH1 knockdown than EZH2 knockdown. Similarly, EZH1 depletion leads to a significantly higher increase in cell migratory ability than EZH2 depletion does. These data suggest a more prominent role of EZH1 than EZH2 in mediating the malignant phenotype of lung epithelial cells with reduced lamin B1 levels. In support of this finding, Kaplan-Meier survival curve showed that lung cancer patients expressing low levels of EZH1 had a significantly poorer prognosis than patients with higher EZH1 expression. Indeed, many studies have shown that EZH1 and EZH2 containing complexes have both common and distinct functions (Margueron et al., 2008; Shen et al., 2008). EZH1 maintains H3K27me3 in terminally differentiated cells, whereas EZH2 establishes and maintains H3K27me3 in proliferating cells (Margueron et al., 2008). In support of this, we observed a markedly higher enrichment of EZH1 in comparison with EZH2 at the Ret promoter. Furthermore, EZH1 and EZH2 also show different biochemical properties. EZH2 has higher catalytic activity towards H3K27me3 than EZH1 and binds to chromatin through JARID2 (Son et al., 2013), whereas EZH1 binds to nucleosomes and induces chromatin compaction independently of PRC1 recruitment (Margueron et al., 2008), suggesting a role of EZH1 loss in chromatin decompaction upon lamin B1 loss.
Mehr anzeigen

167 Mehr lesen

Minimal-invasive approach reduces cardiopulmonary complications in elderly after lung cancer surgery

Minimal-invasive approach reduces cardiopulmonary complications in elderly after lung cancer surgery

A retrospective analysis was performed in patients who underwent curative intent anatomical resection for histologically confirmed, clinical stage T1/2 lung cancer (UICC 7th edition of TNM classification and staging system) at our institution. Our prospectively maintained ESTS database of all patients undergoing thoracic surgery for lung cancer was used to identify those patients. Written informed consent was given by all patients and the study was conducted following the approval of the local Ethics Committee (18-8030-BO). Patients with small cell lung cancer, preoperative chemo- or radiotherapy were excluded. Clinical characteristics included age, gender, BMI, functional status, preoperative comorbidity, lung function, tumor histology, clinical and pathological stage (C-stage and P-stage), operative procedure and approach, postoperative cardiopulmonary complications, 30- and 90-day mortality
Mehr anzeigen

9 Mehr lesen

ZAR1 is a novel epigenetically inactivated tumour suppressor in lung cancer

ZAR1 is a novel epigenetically inactivated tumour suppressor in lung cancer

Based on our findings that ZAR1 is epigenetically inacti- vated in lung cancer cell lines and primary lung cancer tumours, we aimed to test its tumour suppressive prop- erties. Colony formation assays were performed in A549, A427 and HTB171 lung cancer cells that are epigeneti- cally inactivated for ZAR1 (Figs. 1 and 4). ZAR1 reex- pression reduced colony numbers compared to vector control in A549 by 89%, in A427 by 71% and in HTB171 by 51% (Fig. 5a). This growth reduction by ZAR1 was significant for all three lung cancer cell lines when quan- tified (Fig. 5b). For expression control and determining ZAR1 localisation, we used EGFP tagged ZAR1. ZAR1 is found throughout the cytosol, but not within the nu- cleus, which is exemplarily shown for A549 and HeLa cells (Fig. 6a, b). We next questioned if the observed growth inhibition of lung cancer cells by reexpressed ZAR1 could be due to increased apoptosis or arrest of cell cycle progression. We chose different cancer cells as A549 (lung cancer), HeLa (cervix carcinoma) and HCT116 (colon carcinoma) for reexpression of ZAR1. We performed flow cytometry analysis using propidium iodide staining to determine the nuclear DNA content. Flow cytometry in HeLa cells showed that ZAR1 overex- pression increased the number of cells in S phase, but at the same time, no increase in mitosis was observed (Fig. 6c and Additional file 4: Figure S2A). Likewise, ZAR1 expression arrested HCT116 cells in S phase
Mehr anzeigen

12 Mehr lesen

In Silico Comparison of Photons versus Carbon Ions in Single Fraction Therapy of Lung Cancer

In Silico Comparison of Photons versus Carbon Ions in Single Fraction Therapy of Lung Cancer

In the last twenty years, ion beam therapy has proven to be a promising alternative to photon radiotherapy. Higher tumor control rates and better dose conformity can be achieved with superior physical and biological ion properties, when compared to photons [Tsujii et al., 2008, Durante and Loeffler, 2010]. A recent review made by Kamada et al re- ported a high 3-year survival rate for carbon-ions (76.9%) for treating lung cancer in a single fraction, with no late treatment-related complications [Kamada et al., 2016]. The treatment used passive beam scanning, where patient specific absorbers are used to conform the dose to the tumor. Active beam scanning, on the other hand, can provide even better dose shaping, which is essential in hypo-fractionated treatment. However, interaction between tumor and scanned beam motion, called interplay, can severely degrade dose distribution in the breath- ing patient. Therefore designated motion mitigation techniques must be used for successful treatment of lung cancer with active beam scanning [Bert et al., 2008].
Mehr anzeigen

152 Mehr lesen

Health-related quality of life questionnaires in lung cancer trials: A systematic literature review

Health-related quality of life questionnaires in lung cancer trials: A systematic literature review

A comparison with further literature shows that our results are e.g. in line with Liu et al. and also with Salvo et al. [3,54]. The latter conducted a literature review, published in 2009, searching for quality of life measure- ment instruments in cancer patients receiving palliative radiotherapy for symptomatic lung cancer. The authors also concluded that EORTC QLQ-C30 was the most commonly used questionnaire (in 13 of 20 trials). Of those 13 studies, 8 also used the LC13 module. The FACT-L was used in only 2 of the included 20 trials. Salvo et al. furthermore considered that HRQoL was of low priority as an endpoint and that measures created for lung cancer patients were underused.
Mehr anzeigen

11 Mehr lesen

Fine mapping of MHC region in lung cancer highlights independent susceptibility loci by ethnicity

Fine mapping of MHC region in lung cancer highlights independent susceptibility loci by ethnicity

Unravelling candidate functional variants. Using the independently associated HLA alleles and/or haplotypes, their significant amino acids and SNPs, we searched for the best overall HLA model. First, we used a forward selection stepwise regression of significant amino acids within the independently associated regions. For each gene or region we looked for the set of signi ficant amino acid positions and we defined the classical alleles with consistent residues at those positions. We also included as covariates in these risk models the independent markers previously identi fied. The aim was to find the best set of amino acids and/or HLA alleles that were independently associated with lung cancer as judged by the lowest AIC (Akaike Information Criterion) and BIC (Bayesian Information Criterion) 42 , 43 .
Mehr anzeigen

12 Mehr lesen

Expression of Proteolytic Enzymes by Small Cell Lung Cancer Circulating Tumor Cell Lines

Expression of Proteolytic Enzymes by Small Cell Lung Cancer Circulating Tumor Cell Lines

Despite the role of uPA and its receptor uPAR/CD87 as major regulators of ECM degradation, and their involvement in cell migration and invasion under physiological and pathological conditions, they were not found in the CTCs tested here [ 71 ]. Otherwise, this system is involved in the development of most invasive cancer phenotypes and is a strong predictor of poor patient survival [ 72 ]. Furthermore, high serum uPAR(I) levels are associated with short overall survival in SCLC patients and identify chemoresistant cells [ 71 , 73 ]. Endopeptidase CD10 hydrolyzes bioactive peptides, including neuropeptides, but was not found in our assays, in accordance with previous findings demonstrating the absence of CD10 in most SCLCs [ 74 , 75 ]. DPPIV/CD26 is expressed in almost all cases of adenocarcinoma, whereas all cases of squamous cell carcinoma, SCLC, large cell carcinoma and carcinoid were negative [ 76 , 77 ]. ADAM/TSs are involved in the regulation of growth factor activities and integrin functions, leading to promotion of cell growth and invasion [ 78 – 80 ]. ADAM8 is overexpressed in the vast majority of lung cancers and can be a diagnostic marker of lung cancer [ 81 , 82 ]. Extensive cytoplasmic expression of tissue and plasma kallikrein was observed in SCLC and NSCLC, but these enzymes as well as ADAM/TS were not detected in BHGc7/10 [ 83 ].
Mehr anzeigen

13 Mehr lesen

Fachrepositorium Lebenswissenschaften: Implementing WHO recommendations for palliative care into routine lung cancer therapy

Fachrepositorium Lebenswissenschaften: Implementing WHO recommendations for palliative care into routine lung cancer therapy

Objective: A retrospective systematic chart analysis of a two year period was performed. We assumed that seeing patients relatively early during the course of the illness would be reflected by seeing patients that would be not already (i) in a reduced performance status, (ii) experiencing symptoms that are indicators for advanced disease (e.g., dyspnoea and pain) and (iii) close to death. Therefore, the first PC consultation for every lung cancer patient was analyzed to assess in what physical condition patients receive first PC consultation, what burdening symptoms they already experienced and how long the patients lived after their first consultations.
Mehr anzeigen

28 Mehr lesen

Gutenberg Open Science: Soluble triggering receptor expressed on myeloid cells 1 in lung cancer

Gutenberg Open Science: Soluble triggering receptor expressed on myeloid cells 1 in lung cancer

However, sTREM-1 release might depend on other conditions than infection, non-infectious inflammation or cancer. A recent study 27 suggests, that the Trem1 genotype (i.e. the presence of the single nucleotide polymor- phism rs2234246) might contribute to higher or lower sTREM1 levels, irrespective of the factors investigated in our study. Moreover, in our patient series, we do not have complete data on the presence of COPD and infection in every patient as the chart review was done retrospectively. Another limitation of our study is the lack of testing for activating EGFR-mutations although it has an important effect on patients’ survival 28 , due to the fact that this was not part of the clinical routine in 2000–2005, when our patients were diagnosed with lung cancer.
Mehr anzeigen

9 Mehr lesen

Significance of the expression of carbonic anhydrase IX in models of ovarian cancer, gastric cancer and small cell lung cancer / submitted by Lukas Klameth, MSc

Significance of the expression of carbonic anhydrase IX in models of ovarian cancer, gastric cancer and small cell lung cancer / submitted by Lukas Klameth, MSc

In 1912, Isaac Adler wrote the first book dealing with malignant growths of the lung and bronchi and mentioned the abuse of tobacco smoke as one of the possible causes for the disease, but he also stated, that this suggestion is not ready for a final judgment yet. The Springer Handbook of Special Pathology from 1930 recognized, that at the turn of the century (industrially produced cigarettes were available shortly before) the incidence of lung cancer started to rise and that this increase was even stronger after World War I with 10% in 1918 and 14% in 1927, respectively. Till the 1930s, the link between smoking and lung cancer was not well explored by the clinicians but during the next decades, different approaches substantiated this correlation. First medical publications started to be available and about 20 years later, the role of smoking as one cause of lung cancer was established and generally accepted (Proctor, 2012; Witschi, 2001). One of the first published population studies by Franz Hermann Müller from the Cologne Hospital in Germany, compared 86 people with lung cancer with a similar number of people without any malignant diagnosis. He was able to demonstrate that people with lung cancer were far more likely to have smoked than people from the control group (Müller, 1938). These findings were subsequently confirmed by different groups in Germany, UK and US. In 1954, Doll and Hill concluded, that smoking of more than 25 cigarettes per day increased the risk of dying from lung cancer and the American Cancer Society, working together with Hammond and Horn, stated in the same year, that the link now has been proved (Doll & Hill, 1954; Hammond E & Horn D, 1954; Proctor, 2012).
Mehr anzeigen

134 Mehr lesen

Personalized treatment of advanced non-small-cell lung cancer in routine clinical practice

Personalized treatment of advanced non-small-cell lung cancer in routine clinical practice

Abstract Personalized treatment of patients with ad- vanced non-small-cell lung cancer based on clinical and molecular tumor features has entered clinical routine prac- tice. The 2015 pathological classification of lung cancer mandates immunohistochemical and molecular analysis. Therapeutic strategies focused on inhibition of angiogen- esis and growth factor receptor signaling. Inhibitors of angiogenesis and monoclonal antibodies directed against the epidermal growth factor receptor have shown efficacy in combination with chemotherapy. Mutations in the epi- dermal growth factor receptor and anaplastic lymphoma kinase have become clinically relevant therapeutic targets. Immune checkpoint inhibitors are also entering routine clinical practice. Identification of predictive biomarkers is essential and faces several challenges including tumor heterogeneity and dynamic changes of tumor features over time. Liquid biopsies may overcome some of these challenges in the future.
Mehr anzeigen

10 Mehr lesen

Show all 1594 documents...