collagen type II

Top PDF collagen type II:

Millicurrent stimulation of human articular chondrocytes cultivated in a collagen type-I gel and of human osteochondral explants

Millicurrent stimulation of human articular chondrocytes cultivated in a collagen type-I gel and of human osteochondral explants

applied a current density of 10.6 mA/cm 2 , which should allow cellular stimulation. Investigating important genes of cartilage turnover, with respect to chondrocytes culti- vated in a 3 D matrix in-vitro, we found a more univer- sal up-regulation rather than a specific one. Aggrecan and collagen type-II gene expression, which is character- istic for hyaline cartilage, stayed elevated, while expres- sion of the collagen type-I gene, indicating dedifferentiated chondrocytes, was slowly decreasing during cultivation. Immunohistological examination of protein production did not show any obvious enhance- ments with regard to col-II, col-I and proteoglycan pro- duction. This may be due to the relatively short cultivation period of 3 weeks. In contrast, when we trea- ted osteochondral explants, we observed a specific pat- tern of gene expression, with some genes being stimulated (col-I, aggrecan), some genes being repressed (IL-6, MMP-13, TNF-a) and some left unaffected (col- II, IL-1b). One may speculate that the mechanisms of signal transduction are different with regard to 3 D gel culture and osteochondral explant culture, eventually because of missing ECM components in the collagen gel. On the other hand, we recently demonstrated a changed expression profile of a subset of integrins involved in signal transduction when we investigated chondrocytes with different states of differentiation [20]. Therefore, a different expression profile of signal-trans- ducers of chondrocytes cultured in 3 D or explant cul- ture may be involved.
Mehr anzeigen

9 Mehr lesen

Millicurrent stimulation of human articular chondrocytes cultivated in a collagen type-I gel and of human osteochondral explants

Millicurrent stimulation of human articular chondrocytes cultivated in a collagen type-I gel and of human osteochondral explants

RNA was isolated with the Oligotex Direct mRNA Kit (Quiagen, Hilden, Germany) according to the manufacturer’s instruction. Isolated mRNA was used to create the corresponding cDNA by the SuperScript II First Strand Synthesis System (Invitrogen, Carlsbad, CA, USA). Gene expression of collagen type-II, collagen type-I, aggrecan, MMP-13, IL-6, Il-1b and TNFa was quantified by real time PCR on a LightCycler (Roche Diagnostics, Indianapolis, MN, USA). The housekeeping gene b-actin was used as an internal standard. Because of the large variability between the patients, data were presented as relative expression with respect to untreated control samples of the same patients. Primer sequences: Col-I (5-prime: GAGGGCCAAGACGAAGA- CATCC; 3-prime: CACAGAGGGAACCCAGGGAGC), Col-II (5-prime: CTGGTCCTTCTGGCCCTAGAG; 3-prime: AAAGGCGGACATGTCGATG), Aggrecan (5- prime: ATGCCCAAGACTACCAGTGG; 3-prime: TCCTGGAAGCTCTTCTCAGT) Il-1b (5-prime:
Mehr anzeigen

9 Mehr lesen

Collagen metabolism of human osteoarthritic articular cartilage as modulated by bovine collagen hydrolysates

Collagen metabolism of human osteoarthritic articular cartilage as modulated by bovine collagen hydrolysates

Destruction of articular cartilage is a characteristic feature of osteoarthritis (OA). Collagen hydrolysates are mixtures of collagen peptides and have gained huge public attention as nutriceuticals used for prophylaxis of OA. Here, we evaluated for the first time whether different bovine collagen hydrolysate preparations indeed modulate the metabolism of collagen and proteoglycans from human OA cartilage explants and determined the chemical composition of oligopeptides representing collagen fragments. Using biophysical techniques, like MALDI-TOF-MS, AFM, and NMR, the molecular weight distribution and aggregation behavior of collagen hydrolysates from bovine origin (CH-AlphaH, Peptan TM B 5000, Peptan TM B 2000) were determined. To investigate the metabolism of human femoral OA cartilage, explants were obtained during knee replacement surgery. Collagen synthesis of explants as modulated by 0–10 mg/ml collagen hydrolysates was determined using a novel dual radiolabeling procedure. Proteoglycans, NO, PGE 2 , MMP-1, -3, -13, TIMP-1, collagen type II,
Mehr anzeigen

9 Mehr lesen

Effects of -carotene and its cleavage products in primary pneumocyte type II cells

Effects of -carotene and its cleavage products in primary pneumocyte type II cells

These findings indicate that β-carotene cleavage products are most likely responsible for the increased lung cancer risk observed in chemoprevention trials. However, there is a lack of information on the sensitivity of the putative target cells in the lung, namely alveolar type II cells. Alveolar type II cells have a central role in the maintenance of normal lung function, reaction to injury, and response to specific toxins. They express phase I and phase II biotransformation enzymes—particularly cytochrome P450-dependent mono-oxygenases [ 30 ]—and thus are potential targets for many inhaled materials, and at the same time represent the relevant cells for the evaluation of a mutagenic and carcinogenic potential of specific agents [ 31 ]. Therefore, the goal of this investigation was the evaluation of the cyto- and genotoxic potential of β-carotene and its cleavage products in primary rat pneumocytes. 2. Materials and Methods
Mehr anzeigen

14 Mehr lesen

miRNA-154 mediates the transdifferentiation of alveolar type II to alveolar type I cells in the mouse model of Bronchopulmonary Dysplasia

miRNA-154 mediates the transdifferentiation of alveolar type II to alveolar type I cells in the mouse model of Bronchopulmonary Dysplasia

In order to confirm our results and to proof our hypothesis that miR-154-3p is the key regulator of AECII-to-AECI transdifferentiation in the context of hyperoxia, [r]

122 Mehr lesen

Throughput of Type II HARQ-OFDM/TDM Using MMSE-FDE in a Multipath Channel

Throughput of Type II HARQ-OFDM/TDM Using MMSE-FDE in a Multipath Channel

In type II hybrid ARQ (HARQ) schemes, the uncoded information bits are transmitted first, while the error correction parity bits are sent upon request. Consequently, frequency diversity cannot be exploited during the first transmission. In this paper, we present the use of OFDM/TDM with MMSE-FDE and type II HARQ to increase throughput of OFDM due to frequency diversity gain.

5 Mehr lesen

A New-Type Photosystem II Inhibitor which Blocks Electron Transport in Water-Oxidation System 

A New-Type Photosystem II Inhibitor which Blocks Electron Transport in Water-Oxidation System 

Photosystem II, S-State Transition, T herm olum inescence, W ater O xidation, H erbicide The m ode o f action of three types o f conjugated enam ine com pounds was investigated by m eans o f therm olum inescence m easurem ent. Cyanoacrylate and 2-(l-eth oxyeth ylam in om eth yl- id ene)-4-dodecyl-5,5-dim eth yl-cyclohexane-l,3-d ion e (A C m l2 ) converted the B-band (30 °C) arising from S2Q | charge recom bination to a downshifted 6 °C-band. This band was proved to be identical with the D C M U -induced Q -band (6 °C) arising from S2Q A recom bination, indicating that these two com pounds block 0 A to Q b electron transport. 3-(l-d od ecylam in op rop yrid en e)-6- m ethyl-2H -pyran-2,4-dione (A P p l2 ) , on the other hand, induced an abnormal band peaking at 15 °C betw een the Q-band and B-band. From the gradual dow nshift o f its peak temperature in titration experim ents, this band was assigned to arise from a m odified S2Q B charge pair, in which the properties o f either Q i or S2 is altered. The 15 °C-band sh ow ed normal oscillation during the first 2 flashes, but the oscillation was interrupted thereafter. A n oth er therm olum inescence analy­ sis by use o f post flash low temperature illum ination protocol revealed that A P p l2 affects neither Q a to Q b nor Q^- to PQ electron transport, but specifically blocks S3 to Sn transition. T hese results indicate that A P p l2 is a new-type PS II inhibitor.
Mehr anzeigen

9 Mehr lesen

Immunhistochemische Untersuchung der cerebrovaskulären Basallamina mit Collagen Typ IV an Gehirnen von Drogentoten

Immunhistochemische Untersuchung der cerebrovaskulären Basallamina mit Collagen Typ IV an Gehirnen von Drogentoten

In der Medulla oblongata war die Anzahl der Blutgefäße mit schwacher Immunreaktivität in der Drogengruppe signifikant erhöht, wohingegen sich für die anderen Färbei[r]

70 Mehr lesen

Promotion of the collagen triple helix in a hydrophobic environment

Promotion of the collagen triple helix in a hydrophobic environment

The fact that the collagen helix formation is driven by polar interaction between backbone amides (“polar in”) is rather peculiar since this assembly occurs in an aqueous medium, which is polar as well. It would be reasonable to assume that the collagen assembly is better suited for a non- polar environment, where the lipophobic collapse of the chains into the triple helix would hide polar NH fragments from their exposure to the medium. Interestingly, in this case, the formation of the triple helix would resemble the assembly principle of transmembrane α-helical bundles. In the latter structures, compact glycine residues are often utilized to form interhelical interfaces, thereby causing protein assembly in the hydrophobic environment of a lipid membrane. 9–11 We were intrigued by this comparison and asked ourselves whether it is possible to construct a CMP capable of assembling in a hydro- phobic environment of organic solvents or biomembranes. Thereby, collagen could be converted into a membrane handle or even a fully artificial membrane protein. CMPs capable of self-assembling in hydrophobic media might also be functio- nalized with various cargoes to mimic the microenvironment of the different biological settings (e.g., extracellular matrix, cell adhesion or signalling) important for applications in materials science and medicine. 12
Mehr anzeigen

6 Mehr lesen

Collagen Type I Conduits for the Regeneration of Nerve Defects

Collagen Type I Conduits for the Regeneration of Nerve Defects

Materials 2016, 9, 219 2 of 9 autografts are still considered the gold standard for peripheral nerve repair, disadvantages such as donor site morbidity, potential neuroma formation and mismatch in nerve quality and diameter have yielded novel approaches for the purpose of bridging nerve discontinuities [ 14 – 16 ]. Tubular nerve guidance conduits offer a straightforward option for surgical nerve repair that surmount the limitations of autologous nerve transplants. Nerve conduits are either obtainable as synthetic nerve guidance tubes from various biocompatible polymers or can be improvised as autologous transplants from ligated vessel segments [ 11 , 17 ]. Among the synthetic materials applied in human trials are collagen type I/III, acellular nerves, poly( D , L -lactide-caprolactone), polyglycolic acid and silicone [ 18 ]. The tubular space within the conduit, together with neurotrophic and neurotropic factors secreted by the nerve stumps, seem to provide a microenvironment that facilitates axonal sprouting and the formation of a glial sheath for sufficient nerve regeneration [ 11 , 17 ]. Recent studies using collagen conduits for the reconstruction of digital nerves present encouraging results [ 19 , 20 ]. Despite numerous experimental investigations, however, scarce clinical data exist to support the widespread use of guidance conduits, especially in the context of the enduring discussion as to whether or not large-diameter nerve reconstruction could be properly carried out using this approach [ 8 , 21 ]. In this study type I collagen conduits were implanted to bridge traumatic nerve discontinuities of less than 1.2 cm in lacerated nerves of the distal forearm region. The outcome was assessed by static two-point discrimination (S2PD), nerve conduction velocity relative to the uninjured limb, disability of arm shoulder and hand (DASH) outcome measure scoring, and patients’ perceived satisfaction.
Mehr anzeigen

9 Mehr lesen

Development of new inhibitors for the type II transmembrane serine protease matriptase

Development of new inhibitors for the type II transmembrane serine protease matriptase

5 number of human diseases related to these systems. [29] In recent years, subgroups of these enzymes have been identified, which are anchored directly to plasma membranes, either by a carboxy-terminal transmembrane domain (Type I), an amino-terminal transmembrane domain with a cytoplasmic extension (Type II or TTSP), or through a GPI linkage. An additional mechanism is used by uPA (urokinase), which is fixed to the cell surface via binding to a specific uPA-receptor. [30] These trypsin-like serine proteases have a common catalytic mechanism for the cleavage of specific substrates and are frequently involved in consecutive proteolytic reactions or protease cascades, where one protease precursor (zymogen) is the substrate of an active protease. This shared mechanism confers the advantage that a single signal may be specifically and irreversibly amplified at each step, when a downstream zymogen is activated, providing the capacity for unleashing a burst of proteolytic potential. [31]
Mehr anzeigen

196 Mehr lesen

Type I interferon promotes alveolar epithelial type II cell survival during pulmonary inflammation / submitted by Barbara Maier

Type I interferon promotes alveolar epithelial type II cell survival during pulmonary inflammation / submitted by Barbara Maier

bone. Lung macrophages in steady state clear surfactant proteins to keep the alveolar airspaces clear. In fat tissue, macrophages regulate insulin sensitivity and lipolysis. Figure 2 illustrates the tissue specific functions of macrophages [20]. Factors that keep macrophages in their respective phenotype are most likely signals derived from their environment that are largely unknown. Macrophages are characterized by expression of pattern recognition receptors, which are innate receptors that bind to conserved microbial compounds in a rather unspecific manner. In different tissues, macrophages show unique expression patterns of subsets of those receptors, i.e. Toll-like receptors (TLRs), scavenger receptors, Nod-like receptors (NLRs), C-type lectins and RIG-I family proteins [21]. The diversity of different macrophage populations is also reflected on overall gene expression level. A “core signature” has been identified for all macrophage populations, which distinguishes them from other populations of the mononuclear phagocyte lineage. Further, distinct signatures have been found for macrophages from several organs [21].
Mehr anzeigen

93 Mehr lesen

MicroRNA profiling of purified alveolar epithelial type II cells from normal mice

MicroRNA profiling of purified alveolar epithelial type II cells from normal mice

Interestingly, members of the polycistronic miR-17-92 cluster and its two mammalian paralogs miR-106a-363 cluster and miR-106b-25 cluster were highly represented in the ATII miRNAs. These clusters contain four seed families: miR-17, miR-18, miR-19 and miR-92 (Concepcion et al. 2012). In the present study, four miR-17-92 cluster members (miR-19a, miR-17, miR-20a, miR-18a) were detected. MiR-19a and miR-17- 5p were expressed at high levels with miR-17-5p having three targets within the canonical TGF-beta signaling pathway. Further, miR-106a from the miR-106a-363 cluster and all three members of miR-106b-25 cluster (miR-25, miR-93, miR-106b) were expressed at moderate levels. MiR-20b of the miR-106a-363 cluster was found at low level. So far, most studies have described the main role of the miR-17-92 cluster and its paralogs as oncogenes with upregulation in hematopoietic and solid cancers (Concepcion et al. 2012). However, there is growing evidence on its physiological function in normal development with loss of function of miR-17-92 cluster leading to early postnatal death (Ventura et al. 2008) and its potential role in tumor suppression. TGF-beta type II transmembrane receptor was directly inhibited by miR-17, miR-20a and miR-20b and these miRNAs were upregulated in A549 with cisplatin sensitivity compared to cisplatin resistance (Jiang et al. 2014). Further, in oral squamous cell carcinoma miR-17 and miR-20a repressed tumor migration (Chang et al. 2013). Of special interest for the present study, in lung development miR-17, miR-20a and miR- 106b controlled E-cadherin expression and distribution, thus, provoking an epithelial phenotype. MiR-17 and miR-20a were expressed more highly during lung development than in adult lung, while miR-106b had even higher levels in adult lungs (Carraro et al. 2009). In the present study, miR-17, miR-20a and miR-106b were expressed above median levels in ATII cells in adult, healthy mice. These data suggest that not only during lung development, but also in adult mice all three miRNAs have a physiological role in maintaining epithelial homeostasis.
Mehr anzeigen

109 Mehr lesen

The autophagic marker p62 highlights Alzheimer type II astrocytes in metabolic/hepatic encephalopathy

The autophagic marker p62 highlights Alzheimer type II astrocytes in metabolic/hepatic encephalopathy

Fig. 1 Microphotographs of brain sections of hepatic encephalopathy (A-L) and mito- chondrial encephalopathy/Leigh syndrome (M-O). Laminar microvacuolation of the neuropil in cortical layers of the cerebrum is observed in a case of severe hepatic encephalopathy at a low magni fication (arrows in A, B) and at a higher magni fication (D, E). Abundant p62-positive nuclei are identi fied in deep layers at a low magni fication (arrows in C) and at a higher magni fication (F). AA II have the characteris- tic enlarged cell nuclei and clear chromatin (G). AA II forming a triplet of nuclei (H). Small punc- tate condensations along the nuclear membrane in an AA II (I). p62 immunohistochemistry strongly labels the nuclei of AA II, including the peripheral nuclear membrane condensa- tions (arrows in L). (M-O) In a case of Leigh syndrome, glial nuclei in the basal ganglia are also enlarged but show more prominent cytoplasm on HE sta- ined sections than typical AA II (M). p62 shows intense and dif- fuse labeling of enlarged glial nuclei (N, O). HE (A, D, E, G, H, M), LFB-HE (B), p62 immu- nohistochemistry (C, F, J-L, N, O). Scale bars: 200 μm (A–C), 50 μm (N), 20 μm (D–H, J, K–M), 10 μm (I).
Mehr anzeigen

9 Mehr lesen

The temple scroll and the structural properties of collagen

The temple scroll and the structural properties of collagen

keratinocytes [194]. Deterioration of parchment is caused by chemical changes due to gelati- nization, oxidation and hydrolysis mainly of the collagen chains [7]. Historically, the state of degradation of collagen within parchments has been studied using several physical and chem- ical methods. Methods such as shrinkage temperature [195], X-ray scattering [68, 117], ther- mal analysis [196], AFM [197], and solid state NMR [198] provide qualitative information on the physical and chemical integrity of collagen at various levels of the hierarchical structure. However, they are usually invasive, i.e. require small samples of the original material. This fact, together with the intrinsic heterogeneity of the skin material, explains why none of these methods can be used to monitor the state of preservation of the ancient parchment. Therefore, an efficient and non-invasive technique for quantitative damage assessment has great potential for early warning and monitoring systems [199]. Recent attempts to describe the evolution of parchment deterioration use NIR [200], and multispectral imaging techniques [201]. It seems, however, that low spatial resolution and sensitivity result in inaccuracy that outweighs the advantage of the ease of application. Recently, unilateral and solid state NMR techniques showed potential for determining the state of conservation of collagen indirectly, through the relaxation behavior of water molecules involved in the stabilization of the collagen triple helix [198, 202, 203].
Mehr anzeigen

166 Mehr lesen

Enzymatic Degradation and Drug Release Behavior of Dense Collagen Implants

Enzymatic Degradation and Drug Release Behavior of Dense Collagen Implants

k − are rate parameters: k 1 describes the adsorption of collagenase onto the collagen fiber, k − 1 the dissociation of the ES complex without degradation (in general zero (Tzafriri et al.; 2002)) and k 2 the degradation process. The degradation was assumed to be the rate-limiting step, because equilibrium in adsorption was already obtained within 1h (see 4.2.3), whereas degradation last longer (see 4.3). This was in agreement with Tzafriri et al., who modeled the degradation of sparsely fibrillar collagen gels by human skin fibroblast collagenase (Tzafriri et al.; 2002). Hydrolytic erosion of a solid polymer matrix can occur by two extreme mechanisms (see 1.2.3.1). Heterogeneous erosion is restricted to the surface of the device and the undegraded carrier remains chemically intact during degradation. Homogeneous erosion, such as erosion of non cross-linked collagen matrices, involves random cleavage at a uniform rate throughout the complete matrix. While the molecular weight of the polymer decreases steadily, the matrix can remain essentially mechanically intact until 90% of the polymer is degraded. Then mass loss and disintegration of the device starts. In the model for the release of chlorhexidine gluconate from a cross-linked gelatin chip, Tzafriri assumed solely matrix bulk erosion (Tzafriri; 2000). For our dense collagen matrices a combination of surface and bulk erosion is assumed (see 4.3.2.2). Due to enzyme binding at its reaction sites and the dense matrix structure, which hinders diffusion of enzymes and degradation products, it would be incorrect to consider pure bulk erosion. A pure surface erosion, as was proposed by Tzafriri et al. for the degradation of dense collagen fibers (Tzafriri et al.; 2002), would also not reflect the complete digestion process properly, because it was demonstrated that a fully swollen matrix showed a higher degradation rate than a still swelling device (see
Mehr anzeigen

242 Mehr lesen

Novel Dinucleating Ligand Systems Containing Two Adjacent Coordination Compartments of the Potential Triamidoamine-Type -Nickel(II) and Cobalt(II) Coordination Chemistry 

Novel Dinucleating Ligand Systems Containing Two Adjacent Coordination Compartments of the Potential Triamidoamine-Type -Nickel(II) and Cobalt(II) Coordination Chemistry 

Dinuclear transition metal complexes have re­ ceived considerable attention in the past several years, mainly due to the increasing interest in co­ operative effects between individual metal cen­ ters [1, 2]. One fundamental approach to achieve this sought-after cooperativity is the design of din­ ucleating ligand matrices that hold the two metal ions in close proximity by providing adjacent coor­ dination compartments with suitable sets of donor functions [3]. In this regard we have recently studied a series of pyrazolate-based bimetallic complexes, in which the coordination spheres of the metal ions as well as the accessible range of metal-metal sep­ arations can be selectively altered by appropriate changes of the chelating substituents attached to the heterocycle [ 4 - 6 ] . Among these, the representative type I ligands H L 1 and HL 2 can be viewed as two tran-type coordination compartments [tran = tris- (aminoalkyl)amine] coupled by a pyrazole moiety (Scheme 1) [4], However, while these systems gave rise to a diverse chemistry of dinuclear complexes of (usually late) divalent 3d transition metals [ 6 ], they proved less suited for stabilizing complexes of
Mehr anzeigen

12 Mehr lesen

Erdalkaliquadratate, II SrC40 4 * 3 H20 Typ I [1] Alkaline-Earth Squarates, II SrC40 4 -3 H 20 Type I [1] 

Erdalkaliquadratate, II SrC40 4 * 3 H20 Typ I [1] Alkaline-Earth Squarates, II SrC40 4 -3 H 20 Type I [1] 

W e iß e n b e rg a u fn a h m e n bestim m t, welche auf die tri­ kline R a u m g r u p p e P i bzw. P I hinwiesen. Intensitä­ ten w urden m it einem E n raf-N o n iu s-C A D 4 -D iffra k - to m e te r g em essen. D ab ei w urde eine Vollkugel des rezip ro k en R a u m e s bis zu 0 max = 35° ( M o K ä , G r a ­ p h itm o n o c h ro m a t o r) erfaßt. Die Position des Sr2+ ko n n te ein e r P atte rsonsynthe se en t n o m m e n werden. O- und C - A t o m e w urden in D ifferenzfouriersynthe- sen erk a n n t. D ie kristallographischen D ate n sind in de r Tab. I, die A to m p a r a m e t e r in Tab. II zu s am ­ m engefaßt. S tru k tu rfak to rta b ellen w urden beim
Mehr anzeigen

5 Mehr lesen

The impact of collagen membranes on 3D gingival fibroblast toroids

The impact of collagen membranes on 3D gingival fibroblast toroids

There, attachment of periodontal ligament fibroblasts and osteoblast-like cells was tested on different collagen membranes where attached cells showed elongated or round morphology, depending on the membrane type [ 6 ]. In our study monolayers of GF attached in an elon- gated morphology to plastic while they attached in a round morphology to collagen membranes. Previously it was reported that periodontal cells attaching to collagen membranes appear spindle-shaped and flattened in healthy condition. It was proposed that like in 2D mono- layer cultures round morphology would suggest rather unhealthy conditions in scanning electron microscopy [ 18 ]. In our set up we used an fluorescence microscopy approach which did not allow such in-depth evaluation of the cell morphology on our system. In a previous study it was suggested that Interfiber distance of cells to collagen membranes plays a crucial role in attachment regulation [ 18 ]. Periodontal ligament spheroids cultured on collagen membranes or polyglycolic acid membranes showed osteogenic potential when added to dentin [ 10 ]. Here, attachment to dentin was increased with spheroids cultured on polyglycolic membranes compared to those cultured on collagen membranes [ 10 ], suggesting that at- tachment onto a specific material one part of a spheroid could influence attachment activity at free sites of the
Mehr anzeigen

7 Mehr lesen

Inhibition of Photosystem II by Ioxynil in Wild Type and Resistant Mutant of Synechocystis 6714 

Inhibition of Photosystem II by Ioxynil in Wild Type and Resistant Mutant of Synechocystis 6714 

Results Characterization of inhibition by ioxynil of Synecho­ cystis 6714 wild type cells To determine inhibition by ioxynil on the acceptor side, i.e., the inhibition of Q A to Q B electron trans­ fer, we measured fluorescence inductions (Fig. la). It is known that chlorophyll fluorescence yield is con­ trolled by the redox state of Q A. In our conditions, in the absence of herbicide, the fluorescence did not rise much above the initial F0 level because, at 440 nm, photosystem I is preferentially excited and very few centers are in the Q A~ state. Addition of herbicide produced an increase of variable fluores­ cence quasi proportional to the number of PS II cen­ ters blocked by the herbicide.
Mehr anzeigen

6 Mehr lesen

Show all 5285 documents...