SHORT-TERM EFFECTS OF T-2 TOXIN OR DEOXYNIVALENOL ON GLUTATHIONE STATUS
AND EXPRESSION OF ITS REGULATORY GENES IN CHICKEN
Mangesh NAKADE1, Csilla PELYHE2, Benjámin KÖVESI1, Krisztián BALOGH1, Balázs KOVÁCS3, Judit SZABÓ-FODOR2, Erika ZÁNDOKI2, Miklós MÉZES1*
and Márta ERDÉLYI1
1Department of Nutrition, Szent István University, Páter K. u. 1, H-2103 Gödöllő, Hungary; 2Hungarian Academy of Sciences – Kaposvár University ‘MTA-KE Mycotoxins
in the Food Chain’ Research Group, Kaposvár, Hungary; 3Department of Aquaculture, Szent István University, Gödöllő, Hungary
(Received 24 July 2017; accepted 6 November 2017)
Short-term (48-hour) effects of 3.74/1.26 mg kg–1 T-2/HT-2 toxin or 16.12 mg kg–1 DON in feed were investigated in the liver of three-week-old cock- erels (body weight: 749.60 ± 90.98 g). Markers of lipid peroxidation showed no significant changes. At hour 24, glutathione content in the T-2/HT-2 toxin group was significantly higher than in the control. Glutathione peroxidase activity was significantly higher than the control at hour 24 in the T-2/H-2 toxin group and at hour 48 in the DON group. In the DON group, expression of the glutathione pe- roxidase 4 gene (GPX4) was significantly lower than in the control at hours 12 and 14, and higher at hour 48. Expression of the glutathione reductase gene (GSR) was significantly lower than in the control at hour 12 in the T-2/HT-2 toxin group, and at hours 12, 24 and 48 in the DON group. However, at hour 36 higher GSR expression was measured in the DON group. Due to the effect of both trichothe- cenes, expression of the glutathione synthetase gene (GSS) was significantly low- er than in the control at hours 24 and 48. In conclusion, T-2/HT-2 toxin and DON had a moderate short-term effect on free radical formation. T-2/HT-2 toxin in- duced more pronounced activation of the glutathione redox system than did DON.
Key words: Chicken, deoxynivalenol, glutathione peroxidase, gpx genes, T-2/HT-2 toxin
Poultry feeds are often contaminated with Fusarium mycotoxins. ‘Type A’
trichothecene T-2 toxin and its metabolite HT-2 toxin, or ‘type B’ trichothecene
*Corresponding author; E-mail: Mezes.Miklos@mkk.szie.hu; Phone: 0036 (28) 410-735;
Fax: 0036 (28) 410-804
Open Access. This is an open-access article distributed under the terms of the Creative Commons Attribution- NonCommercial 4.0 International License (https://creativecommons.org/licenses/by-nc/4.0/), which permits un- restricted use, distribution, and reproduction in any medium for non-commercial purposes, provided the origi- nal author and source are credited, a link to the CC License is provided, and changes – if any – are indicated.
deoxynivalenol (DON) are frequent mycotoxins in temperate climates (Binder et al., 2007). Trichothecenes present in feed cause reduced production (Grabarevic et al., 1992) and exert toxic effects, among others causing histopathological chang- es in the liver of chickens (Konjevi et al., 2004).
Poultry species are more tolerant to DON than other farm animals (Awad et al., 2008). Reviewing the literature on the effects of DON, Dänicke et al.
(2001) came to the conclusion that only concentrations beyond 5 mg kg–1 diet cause detrimental effects. This relatively high tolerance of poultry is possibly due to the high rate of de-epoxidation of the 12,13-epoxide group of DON by the gut microbiota before absorption (Awad et al., 2008) and the consequent low overall rate of absorption from the small intestine (Greiner and Applegate, 2013). The T- 2 and HT-2 toxin tolerance of chicken is much lower, about 0.5 mg kg–1 feed (Eriksen and Pettersson, 2004).
The results of previous studies show that the effects of T-2 toxin on lipid peroxidation and the glutathione redox system depend on the applied dose and the duration of exposure (Hoechler and Marquardt, 1996). Low-dose and long- term exposure resulted in significantly increased lipid peroxidation and a de- creased amount and activity of the glutathione redox system in chicken (Mézes et al., 1998), but in other studies with higher doses and shorter exposures neither the rate of lipid peroxidation nor the antioxidant parameters showed significant alterations (Frankic et al., 2006; Rezar et al., 2007). The possible cause of the above-mentioned differences is that T-2 toxin can be metabolised via microso- mal xenobiotic transformation in the liver, depending on the dose and duration of the exposure (Ványi et al., 1989). Nevertheless, T-2 toxin may reduce the effec- tiveness of microsomal xenobiotic transformation through a dose-dependent in- hibition of the protein expression of cytochrome P450 enzymes and can induce lipid peroxidation in the microsomes (Guerre et al., 2000). DON also caused dose-dependent oxidative stress in a long-term study with poultry (Awad et al., 2014), while another research revealed that a high dose of DON (10 mg kg–1 feed) did not induce lipid peroxidation and had no effect on glutathione peroxi- dase activity (Frankic et al., 2006). In a short-term study, DON consumption was found to induce phase I and II liver biotransformation enzymes (Gouze et al., 2005). However, the exact mechanism of hepatotoxicity of DON in vivo or in vitro is not known yet (Peng et al., 2017).
Although oxidative stress induced by trichothecene mycotoxins has been reported in several studies, there is a scarcity of information regarding the time and sequence of induction.
The purpose of the present study was to investigate the short-term effect of T-2/HT-2 toxin or DON exposure on lipid peroxidation, amount/activity of the glutathione redox system and the sequence of changes in the expression of gluta- thione-related genes in broiler chicken. Short-term exposure was used for inves- tigating the primary and direct effects of mycotoxins, while long-term studies
were done to study the potentially modified responses to DON or T-2/HT-2 due to possible adaptation of the xenobiotic transforming system to mycotoxin expo- sure or liver damage, which impairs the antioxidant defence.
Materials and methods
Experimental design
A total of 72 three-week-old Cobb 540 cockerels (body weight: 749.60 ± 90.98 g) were randomly assigned into experimental groups of 24 birds each. The short-term trial lasted for 48 h, and started after 12 h of feed deprivation. The ba- sal diet was a commercial broiler feed (13.4 MJ kg–1 AME, 20% crude protein, 10% ether extract, 3.5% crude fibre, 35 mg kg–1 vitamin E and 0.25 mg kg–1 se- lenium). The nutrient content of the diet met the requirements of broiler chickens (Hungarian Feed Code, 2004). Measured mycotoxin concentrations of the com- mercial diet (1 kg) were: T-2 toxin: < 0.10 mg; HT-2 toxin: < 0.10 mg; DON:
0.25 mg, and the experimentally contaminated diets contained (1 kg): 3.74 mg T-2 toxin and 1.26 mg HT-2 toxin or 16.12 mg DON.
The mycotoxin doses were higher (20 times for T-2/HT-2 toxin and 3.22 times for DON) than the limits stated in the relevant EU proposals, where the maximum allowed value in complete feed is 0.25 mg T-2 + HT-2 toxin kg–1 (2013/165/EU), and 5 mg DON kg–1 (2006/576/EC).
Production of mycotoxins and experimentally contaminated feeds, mycotoxin analyses
DON was produced by Fusarium graminearum (NRRL 5883) and T- 2/HT-2 toxin by Fusarium sporotrichioides (NRRL 3299) strains on corn sub- strate according to Fodor et al. (2006). The mycotoxin content of the experimen- tally infected corn substrate was 16,324 mg kg–1 DON, 946 mg kg–1 T-2 toxin and 103 mg kg–1 HT-2 toxin. For the mycotoxin-treated groups a total of 4.5 kg control feed was contaminated by adding 5 g of the DON-containing and 22 g of the T-2/HT-2 toxin containing corn substrate, respectively.
DON content of the feed was determined according to Pussemier et al.
(2006), and T-2 and HT-2 concentration was assayed by the method of Trebstein et al. (2008) using HPLC after immunoaffinity cleanup.
Ethical issues
The experiment was carried out according to the Hungarian Animal Pro- tection Act, in compliance with the relevant EU rules. The experimental protocol was authorised by the Food Chain Safety and Animal Health Directorate of the Pest County Agricultural Office of Hungary (permission number XIV-1-001/
1880-5/2012).
Sampling and measurements
The body weight of all birds was measured at the start of the trial, while at samplings at 12, 24, 36 and 48 h of the trial six randomly selected birds from each group were weighed and sampled. Average individual feed intake was cal- culated from the feed intake of each experimental group, and mycotoxin intake was calculated based on the measured mycotoxin content of the diets.
At the above-mentioned samplings six birds from each group were eu- thanised. After cervical dislocation, liver samples were collected for biochemical analyses and stored at –70 °C until analysis. For gene expression analyses liver samples were taken into liquid nitrogen and stored at –80 °C until analysis. For biochemical and genetic analyses liver homogenates were made with a nine-fold volume of cold (4 °C) physiological saline (0.65% w/v NaCl).
Conjugated dienes (CD) and trienes (CT), the primary products of lipid peroxidation, were measured according to AOAC (1984). Determination of thio- barbituric reactive substances (TBARS) content was carried out in the native liver homogenates, while the other parameters were determined in their 10,000 × g supernatant fraction. TBARS content was determined according to Botsoglou et al. (1994). The concentration of TBARS was calculated using standard curves of increasing concentrations of 1,1,3,3-tetraethoxypropane (Fluka, Buchs), and ex- pressed as malondialdehyde. Reduced glutathione (GSH) content of the 10,000 × g supernatant fraction of liver homogenates was measured as described by Sedlak and Lindsay (1968). Glutathione peroxidase (GPx) activity was determined ac- cording to Lawrence and Burk (1976). GSH content and GPx activity were ex- pressed to protein content of the 10,000 × g supernatant fraction of liver homog- enates, which was determined by the Folin phenol reagent (Lowry et al., 1951).
RNA isolation, reverse transcription and qPCR
Total RNA was purified with Trizol reagent (Molecular Research Centre, Cincinnati) with Phase Lock Gel (5Prime GmbH, Hamburg) from 5–10 mg liver homogenate, according to the manufacturer’s instructions. To avoid genomic DNA contamination, RNA isolates were treated with DNase I (Qiagen, Germantown) according to the supplier’s protocol. The quantity and integrity of total RNA were verified with agarose gel electrophoresis [1.5% in Tris-Borate-EDTA buff- er (89 mM Tris, 89 mM boric acid, 2 mM EDTA), pH 8.0] and with NanoPho- tometer (Implen, Munich) measurement. All samples with ratios of absorption 260:280 nm higher than 2.0 were accepted. The cDNA was produced with Re- vertAID Reverse transcriptase and random nanomer primer from 1 μg of total RNA according the recommended protocol.
The primers for the quantification (Table 1) of the mRNA transcriptional levels of GPX4, GSS, GSR and endogenous control glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes were designed with Primer Express 3.0.1
(Thermo Fisher Scientific, San Jose). GAPDH does not have any known interac- tion with oxidative stress or mycotoxins and was used as an internal control gene in several other studies with mycotoxins in broiler chicken (Awad et al., 2011b;
Yang et al., 2016).
Table 1
Primers used for the quantification of the mRNA transcriptional levels of the target and endoge- nous control (GAPDH) genes
Gene Forward primer Reverse primer
GAPDH TGACCTGCCGTCTGGAGAAA TGTGTATCCTAGGATGCCCTTCAG
GPX4 AGTGCCATCAAGTGGAACTTCAC TTCAAGGCAGGCCGTCAT
GSS GTACTCACTGGATGTGGGTGAAGA CGGCTCGATCTTGTCCATCAG GSR CCACCAGAAAGGGGATCTACG ACAGAGATGGCTTCATCTTCAGTG
The real-time PCR was carried out in duplexes (GAPDH and one target gene) using MGB TaqMan probes (Thermo Fisher Scientific, San Jose) with pooled cDNA template. The pools were formed from equal (100 ng) amounts of cDNA per 6 birds of each sampled group at each sampling point of treatment.
For the qPCR, Maxima Probe qPCR Master Mix (Thermo Fisher Scientific, San Jose) and Step One Plus™ Real Time PCR systems (Applied Biosystems, Foster City) were used. The reaction mix contained 2.5 mM MgCl2 and 5 ng cDNA as well as primers and probes of the target and endogenous control genes (Tables 1 and 2) in 12.5 μL final volume per reaction (Table 2).
Table 2
Final concentration of the primer and probes in the duplex real-time PCR reactions Duplex GAPDH primer
(pM/μl)
GAPDH probe (pM/μl)
Target gene primer (pM/μl)
Target gene probe (pM/μl)
GAPDH and GPx4 2.4 1.3 2.9 2.1
GAPDH and GSS 0.66 0.66 3.96 3.3
GAPDH and GSR 0.66 0.66 3.96 3.3
The PCR profile was 95 °C for 10 min for pre-amplification denaturation, followed by 95 °C 15 sec, 58 °C 30 sec and 72 °C 30 sec for 45 cycles and 72 °C 2 min final elongation; VIC and FAM signals were detected at the end of the ex- tension period. The amplified products were verified with gel electrophoresis.
The relative expression level of the target genes (GPX4, GSS and GSR) and endogenous housekeeping control gene, GAPDH, was determined by StepOne™/StepOnePlus™ Software v2.2 (Applied Biosystems, Foster City) us- ing comparative Ct method. The delta Ct (ΔCt), delta-delta Ct (ΔΔCt) and rela-
tive quantification (RQ = 2ˆ-∆∆Ct) values were calculated with the formula de- scribed by Livak and Schmittgen (2001).
Statistical methods
Statistical analysis of the data (one-way analysis of variance by Student- Newman-Keuls post-hoc test, calculation of means and standard deviations) was performed by MedCalc for Windows, version 16.4 (MedCalc Software, Ostend).
Results
There was no mortality during the trial, and no clinical signs of toxicity were observed. Body weight as well as absolute and relative liver weight were similar in each group (data not shown). The calculated feed intake did not show marked differences among the experimental groups in the same periods of the trial. However, lower feed intake was found in all groups in the period between 12 and 24 h, and a much higher intake was noted between 36 and 48 h (Table 3).
Changes of feed intake resulted in marked changes in the calculated mycotoxin intake of the treated groups as well in the different periods of the trial (Table 3).
Table 3
Calculated feed and mycotoxin intake of broiler chickens Calculated feed (g/bird)
and mycotoxin (mg/bird) intake
Control group T-2/HT-2 toxin-treated
group DON-treated group
Feed
0–12 h 68.13 65.42
12–24 h 42.78 46.39
24–36 h 75.00 47.92
36–48 h 87.50 104.17
T-2 toxin
0–12 h n.d. 0.245
13–24 h n.d. 0.174
25–36 h n.d. 0.179
37–48 h n.d. 0.390
HT-2 toxin
0–12 h n.d. 0.082
13–24 h n.d. 0.059
25–36 h n.d. 0.060
37–48 h n.d. 0.131
DON
0–12 h 0.017 0.017
13–24 h 0.011 0.013
25–36 h 0.019 0.013
37–48 h 0.022 0.031
n.d.: not detectable (< 0.10 mg/kg feed)
The conjugated diene and conjugated triene levels of the liver did not change as a result of T-2/HT-2 toxin or DON exposure (Table 4). Nor did the content of TBARS (the end-product of lipid peroxidation) change in the liver homogenate as a result of short-term mycotoxin treatment (Table 5). In the group fed a diet contaminated with T-2/HT-2 toxin, reduced glutathione (GSH) content of the liver homogenate was significantly higher than in the control at the 24-h sampling (Table 5), while DON had no significant effect. Glutathione peroxidase (GPx) activity was significantly higher than that of the control at hour 24 in the T-2/HT-2 toxin treated group, and at hour 48 in the group fed the DON- contaminated diet (Table 5).
Table 4
Effect of T-2 toxin or DON on conjugated diene (CD) and conjugated triene (CT) levels in the liver of broiler chickens (mean ± SD; n = 6)
Time Control T-2/HT-2 toxin DON
CD (OD 232nm)
12th hour 0.28 ± 0.02 0.26 ± 0.02 0.28 ± 0.01
24th hour 0.34 ± 0.11 0.36 ± 0.12 0.28 ± 0.02
36th hour 0.24 ± 0.01 0.23 ± 0.01 0.23 ± 0.02
48th hour 0.25 ± 0.02 0.24 ± 0.02 0.25 ± 0.02
CT (OD 268nm)
12th hour 0.15 ± 0.01 0.14 ± 0.02 0.15 ± 0.01
24th hour 0.17 ± 0.02 0.18 ± 0.02 0.15 ± 0.01
36th hour 0.12 ± 0.01 0.12 ± 0.01 0.12 ± 0.01
48th hour 0.13 ± 0.01 0.12 ± 0.01 0.13 ± 0.01
The expression of genes encoding the glutathione redox components showed changes at all sampling times in the liver (Table 6). Expression of the glutathione peroxidase 4 gene (GPX4) was lower than in the control at hours 12, 24 and 36 in both mycotoxin-treated groups, but the difference was statistically significant only in the DON-treated group at hours 12 and 24. However, at hour 48, GPX4 expression was found to be significantly higher in the DON-treated group (Table 6). The expression of the glutathione reductase gene (GSR) was significantly lower than in the control at hour 12 in the group treated with T- 2/HT-2 toxin, and at hours 12, 24 and 48 in the DON-treated group. However, at hour 36 the opposite effect was found, as the highest gene expression was meas- ured in the DON-treated group. The expression of the glutathione synthetase gene (GSS) was significantly lower in both mycotoxin-treated groups than in the control at hours 24 and 48.
Table 5
Effect of T-2/HT-2 or DON treatment on lipid peroxidation and glutathione redox parameters in liver homogenates (mean ± SD; n = 6)
Time Control T-2/HT-2 toxin DON
MDA (µmol/g)
12th hour 10.99 ± 2.15 10.12 ± 3.02 9.36 ± 0.54
24th hour 17.95 ± 3.69 12.62 ± 1.88 15.00 ± 4.94
36th hour 10.05 ± 1.37 11.37 ± 2.31 10.04 ± 2.12
48th hour 12.57 ± 3.47 15.51 ± 2.68 12.03 ± 3.24
GSH (µmol/g protein content)
12th hour 3.03 ± 0.75 4.03 ± 1.12 3.55 ± 0.89
24th hour 2.84 ± 1.07 4.56* ± 0.74 3.00 ± 1.17
36th hour 3.46 ± 0.83 3.60 ± 0.58 3.08 ± 0.60
48th hour 2.62 ± 0.40 2.92 ± 0.51 3.15 ± 0.58
GPx (U/g protein content)
12th hour 3.01 ± 0.66 3.99 ± 0.91 3.48 ± 0.68
24th hour 3.10 ± 1.24 4.78* ± 0.67 2.89 ± 0.96
36th hour 3.23 ± 0.88 3.44 ± 0.61 3.16 ± 0.73
48th hour 1.99 ± 0.37 2.54 ± 0.48 2.84** ± 0.49
MDA: malondialdehyde; GSH: reduced glutathione; GPx: glutathione peroxidase; Means designat- ed with different superscripts in the same row indicate significant difference as compared to the control *P < 0.05; **P < 0.01
Discussion
No clinical signs of toxicity and mortality were observed at the applied mycotoxin doses, which supports that broiler chickens have relatively high toler- ance to DON (Dänicke et al., 2001) and moderate tolerance to T-2/HT-2 toxin (Eriksen and Pettersson, 2004). Absolute or relative liver weight did not change as a result of mycotoxin exposure, which is supported by a previous study in which 1 or 5 mg DON/kg feed showed the same results (Awad et al., 2011a). For T-2/HT-2 toxin no data are available regarding these parameters. Due to the var- ying feed intake during to trial there were some differences in the calculated my- cotoxin intake.
Conjugated diene and conjugated triene levels in the liver (the early mark- ers of lipid peroxidation) did not change after short-term mycotoxin exposure, which means that the early effects of mycotoxins did not induce measurable lipid peroxidation. This is also supported by the lack of significant alterations in the TBARS content. These results are different from those reported in long-term studies with low trichothecene mycotoxin doses (Mézes et al., 1998; Awad et al., 2014), while they are similar to the findings of other studies (Frankic et al., 2006;
Rezar et al., 2007) in which high doses of DON or T-2 toxin were used. In the present study, the lack of marked oxidative stress in the liver suggested that this effect of trichothecenes might depend not only on the dose and duration of the treatment, but also on some other factors such as the antioxidant content of the feed.
Table 6
Effect of T-2/HT-2 toxin or DON treatment on the expression of glutathione peroxidase 4, glutathione reductase and glutathione synthetase genes in the liver
(mean ± SD; n = 6; equal amounts of cDNA)
Time Control T-2 toxin DON
Glutathione peroxidase 4 (GPX4)
12th hour 1.05 ± 0.11 0.88 ± 0.12 0.77* ± 0.07
24th hour 1.17 ± 0.10 1.03 ± 0.05 0.96** ± 0.08
36th hour 1.03 ± 0.05 0.92 ± 0.05 1.02 ± 0.07
48th hour 1.02 ± 0.06 1.01 ± 0.11 1.16* ± 0.05
Glutathione reductase (GSR)
12th hour 1.01 ± 0.12 0.50*** ± 0.12 0.17*** ± 0.02
24th hour 0.98 ± 0.01 1.07 ± 0.10 0.39*** ± 0.07
36th hour 0.63 ± 0.02 0.67 ± 0.03 1.57*** ± 0.41
48th hour 1.34 ± 0.32 1.58 ± 0.27 1.07* ± 0.01
Glutathione synthetase (GSS)
12th hour 0.92 ± 0.43 1.23 ± 0.25 0.90 ± 0.31
24th hour 1.57 ± 0.42 0.70** ± 0.16 0.66** ± 0.13
36th hour 1.99 ± 0.74 1.37 ± 0.13 2.46 ± 0.63
48th hour 2.11 ± 0.52 0.47*** ± 0.06 0.99** ± 0.21 Means designated with different superscripts in the same row indicate significant difference as compared to the control *P < 0.05; **P < 0.01; ***P < 0.001
GSH content in the liver, the main site of its biosynthesis (Shelly and Lu, 2013), showed higher values as compared to the control when a diet contaminat- ed with T-2/HT-2 toxin was fed. This can indicate the activation of glutathione biosynthesis due to a moderate oxidative stress induced in the liver by T-2/HT-2 toxin (Zimniak et al., 1997). This result is supported by the moderately higher expression of the glutathione synthetase gene (GSS), in particular during the first period of the trial. It is also in line with the results of a short-term study with rats, where a single oral dose of T-2 toxin (2 mg kg–1 b.w.) increased the expression of oxidative stress-related genes in the liver, 6 and 9–12 h after treatment (Sehata et al., 2005).
Due to DON exposure, the GSS gene expression was also increased, but only in the late period of the trial (between 36 and 48 h), which coincided with
the higher feed and mycotoxin intake in that period. This result is possibly due to the higher feed, including amino acid, intake which might cause activation of GSH synthesis through the expression of the genes encoding its de novo synthe- sis. In addition to this, GSH concentration depends on the rate of reduction of its oxidised form, glutathione disulphide, by the glutathione reductase enzyme. As a result of the mycotoxin exposure, the expression of its gene (GSR) was signifi- cantly lower in the DON-treated group than in the control, except at hour 36 when mycotoxin intake was the lowest during the trial. This result suggests that the moderate increase of GSH concentration in the liver was not caused by the higher rate of reduction of glutathione disulphide by glutathione reductase, but probably by the higher rate of its de novo biosynthesis.
GPx4 activity in the liver homogenates was lower in both mycotoxin- treated groups, in particular during the first period of the trial, when mycotoxin intake was high. This means that during this period trichothecene mycotoxins did not induce oxidative stress, which is required for the activation of the antioxidant defence, either at the gene expression level or at the posttranslational activation of GPx. However, DON caused significantly higher GPx4 activity at hour 48, which means that a longer exposure and appropriate mycotoxin intake are re- quired for the activation, as found also in another long-term study with T-2 toxin (Balogh et al., 2015). This delayed effect was also revealed in a short-term trial with trichothecene mycotoxins in common carp (Pelyhe et al., 2016), which might be due to the rate of absorption (Greiner and Applegate, 2013) or the me- tabolism of mycotoxins in the liver (Awad et al., 2014).
In conclusion, the results revealed that at the applied doses of T-2/HT-2 toxin or DON had a modest effect on oxygen free radical formation, therefore they caused only a moderate activation of the glutathione redox system in the liver of chicken during a short period (48 h) of exposure.
Acknowledgements
The research was supported by the Stipendium Hungaricum Scholarship to MN and by the EFOP-3.6.3-VEKOP-16-2017-00008 project, co-financed by the European Union and the European Social Fund to KB, MM and ME.
References
2006/576/EC (2006): Commission Recommendation on the presence of deoxynivalenol, zearalenone, ochratoxin A, T-2 and HT-2 and fumonisins in products intended for animal feeding.
2013/165/EU (2013): Commission Recommendation on the presence of T-2 and HT-2 toxin in ce- reals and cereal products.
AOAC (1984): Official Methods of Analysis. 14th edition. Method 28.054. Association of Official Analytical Chemists, Arlington.
Awad, W. A., Ghareeb, K., Böhm, J., Razzazzi, E. and Zentek, J. (2008): The impact of Fusarium toxin deoxynivalenol (DON) on poultry. Int. J. Poult. Sci. 7, 827–842.
Awad, W. A., Hess, M., Twarużek, M., Grajewski, J., Kosicki, R., Böhm, J. and Zentek, J.
(2011a): The impact of the Fusarium mycotoxin deoxynivalenol on the health and perfor- mance of broiler chickens. Int. J. Mol. Sci. 12, 7996–8012.
Awad, W. A., Vahjen, W., Aschenbach, J. R. and Zentek, J. (2011b): A diet naturally contaminated with the Fusarium mycotoxin deoxynivalenol (DON) downregulates gene expression of glucose transporters in the intestine of broiler chickens. Livestock Sci. 140, 72–79.
Awad, W. A., Ghareeb, K., Dadak, A., Hess, H. and Böhm, J. (2014): Single and combined effects of deoxynivalenol mycotoxin and a microbial feed additive on lymphocyte DNA damage and oxidative stress in broiler chickens. PLoS ONE 9, e88028. doi: 10.371/journal.
pone.0088028
Balogh, K., Bócsai, A., Pelyhe, Cs., Zándoki, E., Erdélyi, M., Szabó-Fodor, J. and Mézes, M.
(2015): Effects of long-term feeding of graded levels of T-2 toxin-contaminated diets on performance, some lipid peroxide and glutathione redox status parameters of broiler chick- ens J. Poult. Sci. 52, 176–182.
Binder, E. M., Tan, L. M., Chin, L. J., Handl, J. and Richard, J. (2007): Worldwide occurrence of mycotoxins in commodities, feeds and feed ingredients. Anim. Feed Sci. Technol. 137, 265–282.
Botsoglou, N. A., Fletouris, D. J., Papageorgiou, G. E., Vassilopoulos, V. N., Mantis, A. J. and Trakatellis, A. G. (1994): Rapid, sensitive and specific thiobarbituric acid method for measuring lipid peroxidation in animal tissue, food and feedstuff samples. J. Agric. Food Chem. 42, 1931–1937.
Dänicke, S., Gareis, M. and Bauer, J. (2001): Orientation values for critical concentrations of de- oxynivalenol and zearalenone in diets for pigs, ruminants and gallinaceous poultry. Proc.
Soc. Nutr. Physiol. 10, 171–174.
Eriksen, G. S. and Pettersson, H. (2004): Toxicological evaluation of trichothecenes in animal feed.
Anim. Feed Sci. Technol. 114, 205–239.
Fodor, J., Németh, M., Kametler, L., Pósa, R., Kovács, M. and Horn, P. (2006): Novel methods of Fusarium toxins’ production for toxicological experiments. Acta Agraria Kaposváriensis 10, 277–285.
Frankic, T., Pajk, T., Rezar, V., Levart, A. and Salobir, J. (2006): The role of dietary nucleotides in reduction of DNA damage induced by T-2 toxin and deoxynivalenol in chicken leukocytes.
Food Chem. Toxicol. 44, 1838–1844.
Gouze, M. E., Laffitte, J., Dedieu, G., Galinier, A., Thouvenot, J. P., Oswald, I. P. and Galtier, P.
(2005): Individual and combined effects of low oral doses of deoxynivalenol and nivalenol in mice. Cell Mol. Biol. 51 (Suppl.), OL809–OL817.
Grabarevic, Z., Nemanic, A., Jagic, V., Tisljar, M., Artukovic, B., Dzaja, P., Culjak, K. and Rinck, I. (1992): Subacute toxicity of T-2 toxin and DAS in broiler chicks. Vet. Arhiv 62, 317–324.
Greiner, B. and Applegate, T. J. (2013): Modulation of intestinal functions following mycotoxin ingestion: Meta-analysis of published experiments in animals. Toxins 5, 396–430.
Guerre, P., Eeckhoutte, C., Burgat, V. and Galtier, P. (2000): The effects of T-2 toxin exposure on liver drug metabolising enzymes in rabbit. Food Addit. Contam. 12, 1019–1026.
Hoechler, D. and Marquardt, R. R. (1996): Influence of vitamins E and C on the toxic effects of ochratoxin A and T-2 toxin in chicks. Poult. Sci. 75, 1508–1515.
Hungarian Feed Code (2004): Nutrient requirements of broiler chicken. Volume II [in Hungarian].
OMMI, Budapest. pp. 65–67.
Konjevi, D., Sreboan, E., Gudan, A., Lojki, I., Severin, K. and Sokolovi, M. (2004): A pathological condition possibly caused by spontaneous trichotecene poisoning in Brahma poultry: first report. Avian Pathol. 33, 377–380.
Lawrence, R. A. and Burk, R. F. (1976): Glutathione peroxidase activity in selenium deficient rat liver. Biochem. Biophys. Res. Commun. 71, 952–956.
Livak, K. J. and Schmittgen, T. D. (2001): Analysis of relative gene expression data using real- time quantitative PCR and the 2 [-Delta Delta C (T)] method. Methods 25, 402–408.
Lowry, O. H., Rosebrough, N. J., Farr, A. L. and Randall, R. J. (1951): Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275.
Mézes, M., Barta, M. and Nagy, G. (1998): Comparative investigation on the effect of T-2 myco- toxin on lipid peroxidation and antioxidant status in different poultry species. Res. Vet. Sci.
66, 19–23.
Pelyhe, Cs., Kövesi, B., Zándoki, E., Kovács, B., Szabó-Fodor, J., Mézes, M. and Balogh, K.
(2016): Short-term effects of T-2 toxin or deoxynivalenol on lipid peroxidation and the glutathione system in common carp. Acta Vet. Hung. 64, 449–466.
Peng, Z., Chen, L., Nüssler, A. K., Liu, L. and Yang, W. (2017): Current sights for mechanisms of deoxynivalenol-induced hepatotoxicity and prospective views for future scientific research:
A mini review. J. Appl. Toxicol. 37, 518–529.
Pussemier, L., Piérard, J. Y., Anselme, M., Tangni, E. K., Motte, J. C. and Larondelle, Y. (2006):
Development and application of analytical methods for the determination of mycotoxins in organic and conventional wheat. Food Addit. Contam. 23, 1208–1218.
Rezar, V., Frankic, T., Nara, M., Levart, A. and Salobir, J. (2007): Dose dependent effects of T-2 toxin on performance, lipid peroxidation, and genotoxicity in broiler chicken. Poult. Sci.
86, 1155–1160.
Sedlak, J. and Lindsay, R. H. C. (1968): Estimation of total, protein bound and non-protein sulfhyryl groups in tissue with Ellmann’s reagent. Anal. Biochem. 25, 192–205.
Sehata, S., Kiyosawa, N., Atsumi, F., Ito, K., Yamoto, T., Teranishi, M., Uetsuka, K., Nakayama, H. and Doi, K. (2005): Microarray analysis of T-2 toxin-induced liver, placenta and fetal liver lesions in pregnant rats. Exp. Toxicol. Pathol. 57, 15–28.
Shelly, C. and Lu, M. D. (2013): Glutathione synthesis. Biochim. Biophys. Acta 1830, 3143–3153.
Trebstein, A., Seefelder, W., Lauber, U. and Humpf, H. U. (2008): Determination of T-2 and HT-2 toxins in cereals including oats after immunoaffinity cleanup by liquid chromatography and fluorescence detection. J. Agric. Food Chem. 56, 4968–4975.
Ványi, A., Sályi, G., Majoros, G., Glávits, R., Sándor, G. and Bagó, Gy. (1989): Investigations on the connection between T-2 fusariotoxin and monensin in coccidian infected boiler chicken [in Hungarian, with English abstract). Magy. Allatorvosok 44, 293–298.
Yang, L., Yu, Z., Hou, J., Deng, Y., Zhou, Z., Zhao, Z. and Cui, J. (2016): Toxicity and oxidative stress induced by T-2 toxin and HT-2 toxin in broilers and broiler hepatocytes Food Chem.
Toxicol. 87, 128–137.
Zimniak, L., Awasthi, S., Srivastava, S. K. and Zimniak, P. (1997): Increased resistance to oxida- tive stress in transfected cultured cells overexpressing glutathione S-transferase mGSTA4- 4. Toxicol. Appl. Pharmacol.143, 221–229.
