Immunreaktion nach transientem kutanem adenoviralem Gentransfer

Volltext

(1)

Immunreaktion nach

transientem kutanem adenoviralem Gentransfer

Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften der Fakultät für Biologie und Biotechnologie

an der Internationalen Graduiertenschule Biowissenschaften der Ruhr-Universität Bochum

angefertigt in der

Arbeitsgruppe für Molekulare Onkologie und Wundheilung Universitätsklinik für Plastische Chirurgie und Schwerbrandverletzte, Handchirurgiezentrum, Operatives Referenzzentrum für Gliedmaßentumore

(2)

Immune Reaction after

Transient Cutaneous Adenoviral Gene Delivery

Dissertation to obtain the degree Doctor Rerum Naturalium (Dr. rer. nat.) at the Faculty of Biology and Biotechnology International Graduate School of Biosciences

Ruhr-University Bochum

in the

Laboratory for Molecular Oncology and Wound Healing Department of Plastic Surgery, Burn Center

BG University Hospital Bergmannsheil

(3)
(4)

ERKLÄRUNG

Hiermit erkläre ich, dass ich die Arbeit selbstständig verfasst und bei keiner anderen Fakultät eingereicht und dass ich keine anderen als die angegebenen Hilfsmittel verwendet habe. Es handelt sich bei der heute von mir eingereichten Dissertation um sechs in Wort und Bild völlig übereinstimmende Exemplare.

Weiterhin erkläre ich, dass digitale Abbildungen nur die originalen Daten enthalten und in keinem Fall inhaltsverändernde Bildbearbeitung vorgenommen wurde.

Bochum, den 10.05.2012

(5)

Inhaltsverzeichnis

Inhaltsverzeichnis I  Abbildungsverzeichnis IV  Tabellenverzeichnis VI  Abkürzungsverzeichnis VII  Danksagung XI 

1

 

Einleitung 1

  1.1  Die Haut 1.2  Gentransfer 4 

1.2.1  Nicht virale Transfermethoden 4 

1.2.2  Virale Vektoren 5 

1.3  Gentherapie 10 

1.4  Das Immunsystem 12 

1.5  Toll-like Rezeptor Signalweg 13 

1.5.1  Toll-like Rezeptoren 13  1.5.2  Zytokine 16  1.5.2.1  Interferone 16  1.5.2.2  Interleukine 17  1.5.2.3  Chemokine 18  1.5.2.4  Tumornekrosefaktoren 19  1.6  Alternative Signaltransduktion 20  1.6.1  RIG-like Rezeptoren 20  1.6.2  Inflammasomen 22  1.6.2.1  NOD-like Rezeptoren 22  1.6.2.2  HIN-200 Proteine 23  1.6.3  DAI (DLM-1/ZBP1) 25  1.7  Zielsetzung 27 

2

 

Material und Methoden

28

 

2.1  Material 28 

2.1.1  Herkunft der Zellkulturen 28 

2.1.2  Versuchstiere 30 

(6)

2.1.4  Chemikalien, Lösungsmittel und Inhibitoren 31 

2.1.5  Fertige Versuchsansätze 32 

2.1.6  Geräte und weitere Materialien 33 

2.1.7  Zellkulturmedien 35 

2.1.8  Oligonukleotide 36 

2.2  Methoden 38 

2.2.1  Adenovirale Transduktion in einem in vivo Ansatz 38 

2.2.2  Isolierung und Kultivierung von primären humanen Keratinozyten 39 

2.2.3  Kultivierung der HaCaT-, HER911- und HEK293-Zelllinien 41 

2.2.4  Präparation der adenoviralen Vektoren 41 

2.2.5  Extraktion adenoviraler DNA 42 

2.2.6  Transfektion der Zellen 42 

2.2.7  Transduktion von Hautgewebe in einem ex vivo Modell 43 

2.2.8  RNA-Isolierung 45 

2.2.9  cDNA-Synthese 45 

2.2.10  Amplifikation von cDNA-Fragmenten 45 

2.2.11  Messung eines Expressionsverlauf inflammatorischer Faktoren 47 

2.2.12  Inhibierung von Signaltransduktionsmolekülen 48 

2.2.13  Statistik 48 

3

 

Ergebnisse 49

 

3.1  Propagation adenoviraler Vektoren 49 

3.2  Adenoviraler Gentransfer in einem in vivo Modell 50 

3.3  Adenoviraler Gentransfer in epitheliale Zellen 56 

3.3.1  Effizienz adenoviraler Vektoren 56 

3.3.2  Eignung der Zellkulturen 58 

3.3.3  Immunogenität adenoviraler DNA 60 

3.3.4  Kinetik adenoviral induzierter Zytokinexpression 62 

3.4  Adenoviraler kutaner Gentransfer 65 

3.5  Signaltransduktion nach adenoviraler Infektion 68 

3.5.1  Inhibierung von Signaltransduktionsmolekülen 68 

3.5.2  Expressionsverhalten pathogenerkennender Rezeptoren 71 

3.5.2.1  Expression von Toll-ähnlichen Rezeptoren (TLRs) 71 

3.5.2.2  Expression von RIG-ähnlichen Rezeptoren (RLRs) 73 

3.5.2.3  Expression von DAI (DLM-1/ZPB1) 74 

3.5.2.4  Expression von Inflammasom-bildenden Komponenten 74 

3.5.3  siRNA-vermittelte Inhibierung der Genexpression 78 

(7)

4

 

Diskussion 83

  4.1  Immunantwort nach adenoviraler Transduktion in vivo 84  4.2  Immunreaktion nach adenoviraler Stimulation in vitro 85 

4.2.1  Eignung der verwendeten Zellkulturen 85 

4.2.2  Vergleich der adenoviralen Transduktion und Transfektion 88  4.3  Adenoviraler Gentransfer in einem ex vivo Hautspannmodell 91 

4.4  Signaltransduktion nach adenoviraler Stimulation 94 

5

 

Zusammenfassung 103

 

6

 

Summary 105

 

7

 

Literatur 107

 

(8)

Abbildungsverzeichnis

Abbildung 1.1: Schematischer Aufbau der Haut. 2 

Abbildung 1.2: Schematische Darstellung eines Adenovirus. 6 

Abbildung 1.3: Schematische Darstellung des adenoviralen Gentransfers. 7 

Abbildung 1.4: Schematischer Ausbau des Genoms adenoviraler Vektoren. 9 

Abbildung 1.5: In klinischen Studien verwendete Vektorsysteme. 10 

Abbildung 1.6: Signaltransduktion von Toll-like Rezeptoren. 15 

Abbildung 1.7: Signaltransduktion RIG-ähnlicher Rezeptoren. 21 

Abbildung 1.8: Inflammasomabhängige Signaltransduktion. 24 

Abbildung 1.9: DAI-induzierte Signaltransduktion. 26 

Abbildung 2.1: Zeitachse der Versuchsdurchführung. 38 

Abbildung 2.2: Transiente kutane adenovirale Transduktion. 39 

Abbildung 2.3: Isolierung und Kultivierung primärer humaner Keratinozyten. 40 

Abbildung 2.4: Aufbau der BO-Drum®. 44 

Abbildung 2.5: Platzierung und Entnahme humaner Vollhaut in einer Bo-Drum®. 44 

Abbildung 3.1: GFP-Expression in HEK-293-Zellen. 50 

Abbildung 3.2: Zeitlicher Verlauf der GFP-Fluoreszenz in vivo. 52 

Abbildung 3.3: Zeitlicher Verlauf der GFP-mRNA Expression in vivo. 53 

Abbildung 3.4: Expression inflammatorischer Faktoren in vivo. 55 

Abbildung 3.5: Effizienz adenoviraler Vektoren in Keratinozyten. 57 

Abbildung 3.6: GFP-Expression in HaCaT- und HKC-Zellen. 58 

Abbildung 3.7: Vergleichbarkeit von HaCaT- und HKC-Zellen. 59 

Abbildung 3.8: Typ-I-Interferonexpression in Keratinozyten. 61 

Abbildung 3.9: Zytokinexpression in Keratinozyten. 63 

Abbildung 3.10: Induktion Interferon-regulierender Faktoren. 65 

Abbildung 3.11: Tranduktionskontrolle der Bo-Drum®. 66 

Abbildung 3.12: Zytokinexpression nach Transduktion von Bo-Drums®. 68 

Abbildung 3.13: Zytokinexpression nach Inhibierung diverser

(9)

Abbildung 3.14: Induktion von Toll-like Rezeptoren. 72 

Abbildung 3.15: Induktion von RIG-like Rezeptoren. 73 

Abbildung 3.16: Induktion der DAI-Expression. 74 

Abbildung 3.17: Induktion von Inflammasomen. 76 

Abbildung 3.18: Induktion von HIN-200-Proteinen. 77 

Abbildung 3.19: Effizienz verwendeter siRNAs. 78 

Abbildung 3.20: siRNA-vermittelte Inhibierung der mRNA-Expression potentieller

DNA-Rezeptoren. 79 

Abbildung 3.21: Transduktion nach Inhibierung potentieller Rezeptoren. 81 

Abbildung 4.1: Toll-like und RIG-like Rezeptor abhängige Signaltransduktion. 96 

Abbildung 4.2: HIN-200-Proteine. 97 

(10)

Tabellenverzeichnis

Tabelle 1.1: Toll-like Rezeptoren. 14 

Tabelle 2.1: Patientendaten zu den verwendeten primären Keratinozyten. 29 

Tabelle 2.2: Charakteristik der Oligonukleotide. 36 

Tabelle 2.3: Charakteristika der siRNAs. 43 

Tabelle 2.4: Temperaturprofil der semiquantitativen Polymerasekettenreaktion. 46 

Tabelle 2.5: Temperaturprofil der quantitativen Polymerasekettenreaktion. 47 

Tabelle 2.6: Zielproteine der Inhibitoren. 48 

Tabelle 3.1: Aufstellung der erreichten Virustiter. 49 

Tabelle 3.2: Effekte der Inhibierung der mRNA-Expression potentieller

(11)

Abkürzungsverzeichnis

°C Grad Celsius (degree Celsius) AdDNA Adenovirale DNA (adenoviral DNA) AdV Adenoviren (adenoviruses)

AIM2 Fehlend in Melanomen 2 (absent in melanoma 2)

AP-1 Adapterverwandter Proteinkomplex 1 (adaptor-related protein complex 1)

APC Antigenpräsentierende Zellen (antigen presenting cells)

ASC Apoptoseassoziiertes, Speck-ähnliches CARD-enthaltendes Protein (apoptosis-associated speck-like protein containing a CARD)

ATP Adenosintriphosphat (adenosine triphosphate) bp Basenpaare (base pairs)

Ca Kalzium (calcium)

CAR Coxsackie-Adenovirusrezeptor (coxsackie-adenovirus receptor) CARD Caspase-Aktivierungs- und Rekrutierungsdomäne (caspase

activation and recruitment domain) Casp Caspase (caspase)

Da Dalton (dalton)

DAI DNA-abhängiger Aktivator von Interferon-regulierenden Faktoren (DNA-dependent activator of IFN regulatory factor)

DNA Desoxyribonukleinsäure (deoxyribonucleic acid)

Erk Extrazellulär regulierte Kinase (extracellular regulated kinase) FCS Fötales Kälberserum (fetal calf serum)

g Gramm (gram)

g Zentrifugalkraft (centrifugal force)

GFP Grün-fluoreszierendes Protein (green fluorescent protein)

(12)

HDP Host Defense Peptides (host defense peptides)

HIN-200 Hämatopoetische Interferon-induzierbare nukleäre Antigene mit Wiederholungen von 200 Aminosäuren (hematopoietic interferon-inducible nuclear antigens with 200 amino acids repeats)

HKC Primäre humane Keratinozyten (human primary keratinocytes) IF16 Interferon-induziertes Protein 16 (interferon

gamma-inducible protein 16)

IFIX Pyrin- und HIN-Domänen Familienmitglied 1 (pyrin and HIN domain family member 1)

IFN Interferon (interferon)

IFNR Interferonrezeptor (interferon receptor) IKK IκB-Kinase (IκB kinase)

IL Interleukin (interleukin)

IPS-1 IFN-beta Promotor Stimulator I (IFN-beta promotor stimulator I) IRAK IL-1R assoziierte Kinasen (IL-1R associated kinase)

IRF Interferon-regulierender Faktor (Interferon-regulating factor) IU Infektiöse Einheiten (infectious units)

JAK Januskinase (januskinase)

JNK c-Jun N-terminale Kinase (c-Jun N-terminale kinase) kbp Kilobasenpaare (kilobase pairs)

kDa Kilodalton (kilodalton) kV Kilovolt (kilovolt)

LPG2 ATP abhängige RNA-Helikase DHX58 (ATP-dependent RNA helicase DHX58)

LPS Lipopolysaccharid (lipopolysaccharide) LTA Lipoteichonsäure (lipoteichoic acid)

m Meter (meter)

M Molar (molar)

(13)

mda5 Melanomdifferenzierung-assoziiertes Gen 5 (melanoma differentiation associated gene 5)

MHC Haupthistokompatibilitätskomplex (major histocompatibility complex)

MIP Makrophagen-inhibierendes Protein (macrophage inhibitory protein) ml Milliliter (milliliter)

MNDA Antigen der Differenzierung von Zellkernen myeloider Zellen (myeloid cell nuclear differentiation antigen)

MOI Multiplizität der Infektion (multiplicity of infection)

MyD88 Myeloides Differenzierungsantwortgen 88 (myeloid differentiation response gene 88)

NALP NLR-Familie, Pyrindomäne enthaltend 3 (NLR family, pyrin domain containing 3)

NFκB Nukleärer Faktor κ B (nuclear factor κ B)

NLR Nukleotid Bindungs- und Oligomerisierungsdomänen (NOD)-haltiges Protein 1-ähnlicher Rezeptor (nucleotide binding and oligomerization domain (NOD)-containing protein 1 like receptor) nm Nanometer (nanometer)

OD Optische Dichte (optical density)

PAMP Pathogenassoziierte molekulare Muster (pathogen associated molecular pattern) PBS Phosphatpuffer (phosphate buffer)

PCR Polymerase Kettenreaktion (polymerase chain reaction) PGN Peptidoglykan (peptidoglycane)

PYD Pyrindomäne (pyrin domain)

RANTES Reguliert bei Aktivierung, von normalen T-Zellen exprimiert und sezerniert (regulated upon activation, normal T-cell expressed, and secreted)

RIG-I Retinolsäure-induziertes Gen 1 (retinoic acid inducible gene I) RIPK Rezeptorwechselwirkende Serin-/Threoninkinase

(receptor-interacting serine/threonine kinase)

(14)

RLU Relative Fluoreszenzeinheit (relative fluorescent unit) RNA Ribonukleinsäure (ribonucleic acid)

rpm Umdrehungen pro Minute (rounds per minute) rRNA Ribosomale RNA (ribosomal RNA)

RT Raumtemperatur (room temperature) RT-PCR Echtzeit-PCR (real-time PCR)

SOCS Suppressor der Zytokinsignalwirkung (suppressor of cytokine signalling)

STAT Signaltransduktoren und Aktivatoren der Transkription (signal transducers and activators of transcription)

STING Transmembranprotein 173 (transmembrane protein 173) TACE TNFα konvertierendes Enzym (TNFα converting enzyme)

TGF Transformierender Wachstumsfaktor (transforming growth factor) TLR Toll-ähnlicher Rezeptor (Toll-like receptor)

TNF Tumornekrosefaktor (tumor necrosis factor)

(15)

Danksagung

Besonderer Dank gilt zunächst Herrn Prof. Dr. Lars Steinstraesser für die Vergabe des interessanten Promotionsthemas, die zielgerichtete Betreuung mei-ner Arbeit sowie die Bereitstellung des Arbeitsplatzes.

Ich danke Herrn Prof. Dr. Günter A. Schaub für sein Interesse an meiner Arbeit, die hilfreiche Unterstützung und die freundliche Übernahme des Korreferats.

Herrn Dr. phil. nat. Frank Jacobsen danke ich für seine wertvollen Anregungen

und Ratschläge bei der Planung und Durchführung der Experimente sowie für das Korrekturlesen meiner Arbeit.

Ein großer Dank geht aber auch an meine Kollegen der Arbeitsgruppe für mole-kulare Onkologie und Wundheilung, denn die Zusammenarbeit mit Ihnen war ein Meilenstein bei der Erstellung meiner Doktorarbeit. Sie gaben mir mit Ihrem fun-dierten Fachwissen viele Anregungen für meine wissenschaftliche Arbeit. Inssondere Andrea Rittig, Mustafa Becerikli und Dr. Jennifer Hauk bin ich zu be-sonderem Dank verpflichtet. Ohne ihr Wissen, ihre Ideen und ihre Kritik wäre mein Forschungsprojekt niemals soweit gekommen.

Des Weiteren danke ich Stephan Winkelmann für die hilfreichen Ratschläge bei der Illustration von Signaltransduktionswegen und der Anwendung der dafür be-nötigten Grafiksoftware.

(16)

1 Einleitung

1.1 Die Haut

Mit einer Anzahl von rund zwei Milliarden Zellen und einer Fläche von bis zu zwei Quadratmeter erreicht die Haut ein Gewicht von zehn bis zwölf Kilogramm und ist damit das größte Organ des Menschen [1, 2]. Als Grenzfläche steht sie in ständigem Kontakt mit ihrer Umwelt und ist dabei permanent äußeren Einflüssen ausgesetzt. Sie schützt vor Austrocknung des Körpers sowie vor chemischen, physikalischen und mechanischen Beanspruchungen durch die Außenwelt. Als erste Barriere zwischen Körper und Umwelt steht die Epidermis (Abbildung 1.1), welche aus vier beziehungsweise fünf Schichten besteht. Die Oberfläche wird aus Schichten terminal differenzierter, verhornter Zellen gebildet, dem Stratum cor-neum (Hornschicht). In besonders dicken Bereichen der Epidermis findet sich da-runter als zusätzlicher Schutz vor mechanischer Beanspruchung die schmale, durchsichtige Glanzschicht (Stratum lucidum). Diese ist jedoch nur in stark ver-hornten Hautarealen, wie die Handfläche oder die Fußsohle, vorzufinden. Daran basal angrenzend folgt das Stratum granulosum (Körnerschicht), welches durch eine fortschreitende Verhornung und den Abbau von Zellen für den Erhalt des Stratum corneum sorgt. Darunter liegt als stabilisierende Schicht das Stratum spi-nosum, welche durch kubische, über Desmosomen verbundene Keratinozyten zu erkennen ist. Am Grund der Epidermis befinden sich basale Keratinozyten (Stra-tum basale), die durch Teilung und Differenzierung für den Erhalt der Epidermis sorgen. In dieser Schicht sind neben den Keratinozyten, welche ca. 90 % der epi-dermalen Zellen ausmachen, unter anderem auch „Langerhanszellen“ genannte, spezialisierte Zellen des Immunsystems vorzufinden. Diese antigenpräsentieren-den Zellen (APC) werantigenpräsentieren-den antigenpräsentieren-den antigenpräsentieren-dendritischen Zellen zugeordnet und bilantigenpräsentieren-den eine effektive Barriere gegen pathogene Mikroorganismen [2, 3]. Darüber hinaus sind auch Merkelzellen (Mechanorezeptoren) und pigmentbildende Melanozyten vor-zufinden. Unterhalb der Epidermis lokalisiert liegt die Basallamina, gefolgt von ei-nem kollagenreichen Bindegewebe (Dermis). Die unterste Schicht der Haut bildet das subkutane Fettgewebe [2].

(17)

proteine, wie kleine prolinreiche Proteine, Lorikrine, Zytokeratine, Filaggrine und Involukrine, erreicht [1, 2, 4]. Darüber hinaus werden Mikroorganismen durch kontinuierliche Desquamation von Hautschuppen abgeschieden [1]. Wie andere Epithelien des Körpers, ist auch die Haut von einer Vielzahl von Mikroorganismen, den Kommensalen, besiedelt (102 bis 107 Organismen pro Quadratzentimeter). Diese angepasste Bakterienflora schützt den Körper ebenfalls gegen eine Be-siedlung durch neue Eindringlinge [2]. Einen zusätzlichen Schutz vor Erregern bie-tet die Haut zum Beispiel durch die Synthese antiviraler Faktoren, den Interfe-ronen, und antimikrobieller Peptide, neuerdings aufgrund ihrer vielfältigen Funktio-nen auch „Host Defense Peptides“ (HDP) genannt [2, 5-9]. Diese zeigen neben der antimikrobiellen Wirkung noch eine Vielzahl anderer Funktionen wie Förde-rung der Wundheilung und Angiogenese sowie immunmodulatorische Wirkungen [10, 11].

(18)

Eine Verletzung der epidermalen Barriere führt zu einer Einschränkung der kutanen Schutzfunktion. Kritisch sind dabei großflächige Beschädigungen bis hin zu der Zerstörung der Hautstruktur, wie es zum Beispiel bei schweren Verbren-nungswunden der Fall ist. Schon eine Verbrennung von zehn Prozent der Körper-oberfläche kann bei einem Erwachsenen zu einer Verbrennungskrankheit und einer damit verbundenen posttraumatischen Immunsuppression führen [12]. Dies hat eine gestörte Funktion der zellulären und humoralen Immunabwehr und somit auch eine fehlerhafte Erkennung und Elimination von Pathogenen zur Folge. Da das Wundgewebe einen idealen Nährboden für bakterielles Wachstum bietet, ebnet der Verlust der epithelialen Schutzfunktion den Weg für eine mikrobielle Invasion [13, 14]. Die dabei in 12 % der Fälle (ungefähr 700 Patienten pro Jahr in Deutschland) eintretende Sepsis gilt als Haupttodesursache bei Brandverletzun-gen [15, 16].

Auch bei chronischen Wunden ist die Immunabwehr stark reduziert und die Infektanfälligkeit sehr ausgeprägt [17]. Bei einer steigenden Prävalenz sind bereits heute zwischen zwei und vier Millionen Menschen allein in Deutschland aufgrund von chronischen Wunden oder Wundheilungsstörungen in Behandlung [18, 19]. Die jährlichen Gesamtkosten für das Gesundheitssystem belaufen sich dabei auf ein geschätztes Kostenvolumen von drei Milliarden Euro alleine für Deutschland [18].

Eine Infektionsausbreitung ist zwar durch die Verabreichung von Antibiotika behandelbar, doch durch die stark ansteigende Anzahl von antibiotikaresistenten Erregern wie Pseudomonas aeruginosa, Methillicin-resistenten Staphylokokken und Vancomycin-resistenten Enterokokken in Kliniken ist die erfolgreiche Antibioti-katherapie nicht mehr gewährleistet [20]. In Folge dessen führt eine adäquate Wundversorgung bei Patienten meist zu großflächigen Wundexzisionen und Amputationen [21]. Dies ist nur durch neue Therapieansätze, die vorbeugend vor Infektionen schützen, zu vermeiden.

(19)

von bis zu drei Millimeter [22]. Zudem werden die antimikrobiellen Eigenschaften der kationischen Peptide durch physiologische Konzentrationen von divalenten Kationen, Serum und anionischen Makromolekülen wie Glucosaminoglykane deutlich gehemmt [6, 7].

1.2 Gentransfer

Eine mögliche Alternative zu der topischen Applikation von HDPs ist der tran-siente kutane Gentransfer in das Wundgewebe. Dabei werden mit Hilfe von geeigneten Transportvehikeln, sogenannte Vektoren, gewünschte Gene in die noch verbliebenen, gesunden Hautzellen effektiv eingeschleust und dort stabil oder extrachromosomal exprimiert [23, 24]. Die Vorteile eines kutanen Gentrans-fers liegen in der leichten Erreichbarkeit und Kontrollierbarkeit der Haut: Bei Ne-benwirkungen können die modifizierten Zellen leicht entfernt werden. Darüber hinaus gelten Keratinozyten als sekretorische Zellen, welche Stoffe wie Zytokine, Enzyme oder Adhäsionsmoleküle mit autokrinen, parakrinen und endokrinen Funktionen sezernieren. Aus diesem Grund wäre ein Gentransfer in die Haut auch für die Behandlung systemischer Krankheiten geeignet [25]. Ein häufiger, für den Patienten oftmals traumatischer und schmerzhafter Verbandswechsel während der Reapplikation der Peptide würde durch einen transienten Gentransfer eben-falls reduziert.

Eine wichtige Vorraussetzung für einen erfolgreichen Gentransfer ist ein ge-eignetes Verfahren für den Transfer von DNA in eine Zelle. Grundsätzlich stehen hierbei zwei Verfahren zur Verfügung: der nicht virale Gentransfer mit Hilfe von Plasmiden sowie der virale Gentransfer mittels modifizierter Viren [26].

1.2.1 Nicht virale Transfermethoden

Nicht virale Transfermethoden werden überwiegend in der Grundlagenfor-schung für die Transfektion von eukaryotischen Zellen verwendet. Dabei wird die DNA, meistens in Form von Plasmiden bakteriellen Ursprungs, in die Zielzellen eingebracht. Hierfür stehen diverse Verfahren zur Verfügung:

(20)

rezeptor-vermittelte Aufnahme der Nukleinsäuren. Dabei wird DNA an ein Protein gebun-den, welches über einen Oberflächenrezeptor erkannt und in die Zelle aufgenom-men wird. Des Weiteren können Nukleinsäuren durch Elektroporation, bei der Zellmembranen durch einen elektrischen Impuls (>1 kV) für DNA-Fragmente permeabilisiert werden, in Zellen eingebracht werden. Die jedoch am häufigsten verwendete Methode ist die Lipofektion. Mit Hilfe von künstlich hergestellten Lipo-somen oder kationischen bzw. Phospholipidvesikeln, welche leicht mit der Zell-membran fusionieren, wird die DNA in die Zellen gebracht [27, 28]. Die Vorteile von Plasmidvektoren liegen in der einfachen Herstellung und Handhabung, jedoch sind diese Methoden in der Regel von geringer Effizienz und werden überwiegend in vitro und ex vivo angewendet. Dabei werden in der Literatur Transfektionseffizienzen von 20 bis 40 % beschrieben, welche in der Praxis je-doch meist deutlich geringer ausfallen. Bei Applikationen von Nukleinsäuren in vivo wird vorwiegend nackte Plasmid-DNA in das Zielgewebe injiziert [28].

1.2.2 Virale Vektoren

Für einen Gentransfer in Zellen höherer Eukaryoten werden dagegen pri-mär virale Vektoren verwendet. Hierbei handelt es sich um modifizierte Viren, bei denen Teile des viralen Genoms durch eine gewünschte DNA-Sequenz ersetzt wurden. Es wird, je nachdem ob eine für die Replikation wichtige virale Gense-quenz deletiert wurde, zwischen replikationskompetenten und -defizienten Vekto-ren unterschieden [29]. Mit deVekto-ren Hilfe können Gene gezielt transient oder stabil in ein Gewebe eingebracht und dort exprimiert werden. Aufgrund ihrer Fähigkeit, ein breites Spektrum proliferierender und nichtproliferierender Zellen zu transduzieren, gelten Adenoviren als die derzeit effizientesten Vektoren für einen transienten Gentransfer [30-32].

(21)

Humane Adenoviren (hAdV) sind mit sieben Spezies (hAdV-A bis -G) nur in der Gattung der Mastadenoviren vertreten [33]. Bisher wurden insgesamt über 52 verschiedene humanpathogene Serotypen beschrieben. In ihrem Wirt verursachen sie milde Atemwegserkrankungen und sind aufgrund ihres häufigen Vorkommens selbst in gesunden Individuen nachzuweisen [34].

Abbildung 1.2: Schematische Darstellung eines Adenovirus.

(22)

Abbildung 1.3: Schematische Darstellung des adenoviralen Gentransfers.

Adenovirus bindet an CAR auf der Zelloberfläche (A). Gebundenes Adenovirus bindet an Integrinrezeptor (B). Einstülpung der Zellmembran, Enstehung eines Endosoms (C). Ansäuerung des Endosoms (D). Zerstörung des Endosoms und der adenoviralen Kapsid-hülle unter Freigabe adenoviraler DNA ins Zytoplasma (E - F). Transport der adenoviralen DNA in den Zellkern (G).

(23)

exprimiert und nicht, wie zum Beispiel bei den Retroviren, in das Wirtsgenom integriert [29, 36].

Nach dem Eintritt der adenoviralen DNA in den Zellkern erfolgt die Transkription des viralen Genoms. Dieses besteht aus insgesamt fünf kodierenden Bereichen, den frühexprimierten (E; „early“) und spätexprimierten Regionen (L; „late“). Vier dieser Regionen (E1 bis E4) werden den frühexprimierten Genen zugeordnet und sind für die erfolgreiche Replikation des Virus essentiell. Die späten Regionen (L-Gene) kodieren für Struktur- und Kapsidproteine des Virus [33].

Die E1-Gene (E1A und E1B) werden sofort nach der Infektion exprimiert und sind dabei unabhängig von anderen viralen Proteinen. E1A dient als Transkiptionsaktivator für die anderen E-Regionen und darüber hinaus als Inhibitor des Retinoblastomproteins (Rb105 und Rb107) und des Tumorsupressorproteins p53. Dies führt zum Eintritt der Zelle in die S-Phase und somit zur Synthese von essentiellen Faktoren für die Replikation, welche sich das Virus zunutze macht [27]. Zeitgleich inhibiert das E1B-Protein durch Regulation von Cytochrom c aus dem Mitochondrium die Apoptoseinduktion [35]. Die für die Replikation des Virus benötigte DNA-Polymerase wird unter anderem von der E2-Region exprimiert. Bei den E3-Proteinen handelt es sich um eine Vielzahl kleiner Proteine, welche von einem für die Replikation des Virus nicht essentiellen Bereich des Genoms kodiert werden. Deren wichtigste Funktion beinhaltet die Unterdrückung der zellulären Immunantwort durch Regulation der Neusynthese von auf der Zelloberfläche lokalisierten MHC-Klasse-I Molekülen. E4-Proteine erfüllen, soweit bekannt, ähnli-che Funktionen wie die E1B-Proteine und interagieren mit Protein p53 [33, 35].

Durch einen Austausch verschiedener früh exprimierter Regionen (E1, E2 oder E4) der viralen DNA gegen ein beliebiges Gen, ist es möglich, die Replikation des Virus und die damit verbundene Lyse der Wirtszelle zu unterbinden. Die Re-gion E3 kann ebenfalls ausgetauscht werden, was jedoch nicht zu einer Inaktivie-rung der Replikation führt. Heute wird zwischen erster, zweiter und dritter Genera-tion adenoviraler Vektoren unterschieden:

(24)

Alle weiteren früh und spät exprimierten viralen Gene sind in dieser Generation jedoch noch enthalten [37]. In Vektoren der zweiten Generation, die zusätzlich Deletionen der E2- und E4-Region aufweisen, sind nur die spät exprimierten Regionen noch vorhanden (Abbildung 1.4). Die Kapazität dieser Vektoren beträgt bis zu 14 kB. Die neueren Vektoren der 3. Generation, die „gutless-Vektoren“, besitzen keine Gene der E- und L-Regionen des Virus und können somit transge-nes Material von insgesamt 38 kB aufnehmen. Im Genom dieser Vektoren sind vom Adenovirus nur die cis-aktiven Sequenzen für die Replikation und Verpa-ckung des viralen Genoms verblieben [29, 35, 37].

(25)

1.3 Gentherapie

Durch die Möglichkeiten zur gezielten Manipulation des viralen Erbguts so-wie die Entschlüsselung des humanen Genoms bietet die Gentherapie eine inno-vative Methode zur alternativen Behandlung eines breiten Spektrums von Krank-heitsbildern [38, 39]. Die in den letzten 22 Jahren häufigste klinische Anwendung war in 64,5 % der registrierten klinischen Studien die onkolytische Behandlung von malignen Tumorzellen. Abgesehen davon gab es bisher diverse gentherapeuti-sche Studien über die Behandlung von Patienten mit Herz- und Gefäßkrankheiten, genetischen Defekten sowie Infektionskrankheiten. Insgesamt wurden seit 1989 mehr als 1700 klinische Studien zu gentherapeutischen Behandlungskonzepten registriert, davon 63,7 % in den USA, und 25 % in Europa. Die hierbei am häu-figsten verwendeten Vektoren sind mit 24,1 % adenoviralen und 20,8 % retrovira-len Ursprungs (Abbildung 1.5). Hierbei spieretrovira-len neben den viraretrovira-len Vektoren auch die nichtviralen Transfektionsmethoden mit Plasmid-DNA, welche in 18,7 % der Studien verwendet werden, eine erhebliche Rolle [38].

Abbildung 1.5: In klinischen Studien verwendete Vektorsysteme.

Auswertung klinischer Studien seit 1989; modifiziert nach Edelstein et al. [38].

(26)

versorgen [41-44]. Weitere Vorteile liegen im Vergleich zu anderen viralen Vekto-ren in der leichten Handhabung der AdenoviVekto-ren. Eine für andere Virusgattungen beschriebene Kanzerogenität im Menschen wurde für Adenoviren im Menschen bisher nicht gezeigt. Des Weiteren werden bei der Herstellung adenoviraler Vekto-ren Titer von mehr als 1012 Partikel/ml erreicht [27, 29, 33, 35].

Ein großer Nachteil der Verwendung adenoviraler Vektoren liegt in der In-duktion einer humoralen und zellulären Immunreaktion [35]. Diese beinhaltet sowohl die Sekretion großer Mengen von Zytokinen als auch die Rekrutierung von Immunzellen wie Makrophagen/Monozyten, Natürliche Killer (NK) Zellen und Granulozyten [35, 45]. Durch die Präsentation adenoviraler Peptide durch MHC-Klasse-I Moleküle an der Zelloberfläche transduzierter Zellen werden diese durch das adaptive Immunsystem erkannt und eliminiert [35]. Die Aktivierung einer adaptiven Immunantwort führt darüber hinaus zu einer beschleunigten Eliminierung der transduzierten Zellen nach mehrmaliger Applikation der Vektoren. In Folge dessen ist ein effektiver Gentransfer auf eine einmalige Anwendung beschränkt [46]. Das häufige Vorkommen von Adenoviren in der Umwelt führt zu einer großen Anzahl von seropositiven Menschen in der Bevölkerung, wodurch bereits eine Erstapplikation zu erheblich abweichenden Wirkungen führt [33, 34]. In einer Studie von Chirmule et al. wurden in nahezu allen Patienten Antikörper gegen Adenoviren nachgewiesen [47].

(27)

1.4 Das Immunsystem

Das phylogenetisch älteste, sogenannte angeborene Immunsystem steht zeitlich und räumlich vor dem adaptiven Immunsystem und wird nach Kontakt mit einem Pathogen als erstes aktiv. Dieses oftmals auch unspezifisch genannte Immunsystem stützt sich auf phagozytierende Zellen und Proteine und wird daher in zelluläre und humorale Komponenten unterteilt. Beim Menschen gehören zum zellulären Teil neutrophile Granulozyten sowie mononukleäre und polymorpho-nukleäre Phagozyten und zum humoralen Teil unter anderem die Lysozyme, das Lipopolysaccharid-bindende Protein, Zytokine, das Komplementsystem und anti-mikrobielle Peptide [56]. Die angeborene Immunabwehr vermag konservierte Merkmale potenzieller Pathogene zu erkennen, fungiert bei Vertebraten aber neben ihrer Abwehrfunktion auch als Mittler der adaptiven Abwehr [57]. Die Sys-teme der spezifischen und unspezifischen Immunantwort stehen dabei unter anderem über die Interleukine, Chemokine und Interferone in engem Kontakt miteinander [58].

Das ausschließlich bei Vertebraten vorkommende adaptive Immunsystem hat sich erst vor rund 500 Millionen Jahren entwickelt. Mit Hilfe von B- und T-Lym-phozyten werden bekannte Erreger durch das adaptive Immunsytem binnen kurzer Zeit hochspezifisch abgewehrt. Das adaptive Immunsystem wird, wie das angeborene Immunsystem, ebenfalls in humorale und zelluläre Komponenten unterteilt. Im Verlauf humoraler Immunreaktionen sezernieren B-Lymphozyten Immunglobuline, die Antigene potenzieller Erreger binden und damit Interaktionen mit Wirtszellen unterbinden. Im Laufe einer zellulären Immunantwort reagieren aktivierte T-Lymphozyten direkt gegen ein pathogenassoziiertes Antigen auf infizierten Wirtszellen und zerstören diese direkt oder veranlassen deren Pha-gozytose [35]. Darüber hinaus differenziert ein Teil der stimulierten B- und T- Lymphozyten zu Gedächtniszellen, die dem Organismus eine schützende Immu-nität gegen Re-Infektionen mit dem gleichen Erregertyp verleihen.

(28)

[58]. In diesem Zusammenhang gilt eine Gruppe hoch konservierter Rezeptoren, die sogenannten Toll-like Rezeptoren, als wichtigste Gruppe für die Erkennung von Pathogenen [46, 60, 61].

1.5 Toll-like Rezeptor Signalweg 1.5.1 Toll-like Rezeptoren

Toll-like Rezeptoren (TLRs) sind Transmembranmoleküle, bestehend aus einer extrazellulären, Leucin-reichen Domäne und einem zytoplasmatischen Teil, welcher dem Interleukin-1 Rezeptor ähnelt. Bisher wurden im Menschen elf unter-schiedliche Toll-like Rezeptoren und einige ihrer Liganden identifiziert und cha-rakterisiert (Tabelle 1.1) [35, 58]. Diese Rezeptoren sind in der Zelle entweder auf der Plasmamembran (TLR-1, -2, -4, -5, -6, -10 und -11) oder endosomal (TLR-3, -7, -8 und -9) lokalisiert. TLR-10 wurde durch in silico Analysen charakterisiert und wird in lymphoiden Geweben exprimiert [35, 62-64]. Die genaue Lokalisation in der Zelle bzw. entsprechende Liganden sind bisher noch nicht bekannt.

Mitglieder dieser Rezeptorfamilie sind in der Zelle für die Erkennung von pathogenassoziierten molekularen Mustern (pathogen associated molecular patterns; PAMP) essentiell [35]. Die von den TLRs erkannten PAMP umfassen verschiedene Liganden meist mikrobiellen Ursprungs (Tabelle 1.1). Für die Detektion von Adenoviren, genauer gesagt der adenoviralen DNA, wurde vor allem die Beteiligung von TLR-9 in der Vergangenheit intensiv diskutiert [45, 61, 65, 66].

(29)

Tabelle 1.1: Toll-like Rezeptoren.

Auflistung humaner Toll-like Rezeptoren (TLR), entsprechender Liganden und Adaptermo-leküle (Modifiziert nach Schütt et al. [58]. ZPM = Zytoplasmamembran; EM = Endosomenmembran).

Rezeptor Lokalisation Liganden Adapter

TLR 1/2 ZPM triacylierte Lipopeptide MyD88

TLR 2 ZPM Peptidoglycan, Lipoarabinomannan, Modulin,

Zymosan, Glycosylphosphatidyl-Inositol, Hämagglutinin MyD88

TLR 2/6 ZPM diacylierte Lipopeptide MyD88

TLR 3 EM dsRNA TRIF

TLR 4 ZPM Lipopolysaccharide, virale Membranproteine MyD88 / TRIF

TLR 5 ZPM Flagellin MyD88

TLR 7 EM ssRNA MyD88

TLR 8 EM ssRNA MyD88

TLR 9 EM unmethylierte CpG-Motive in DNA MyD88

TLR 10 ZPM unbekannt unbekannt

TLR 11 ZPM profilinähnliche Strukturen, Proteinkomponenten unbekannt

Unter Beteiligung von IRAK-Kinasen (IL-1R assoziierte Kinasen) werden in einem mehrstufigen Vorgang Mitglieder der Proteinkinasefamilie IKK (IκB-Kinase) aktiviert, welche den Inhibitor IκB des Transkriptionsfaktors NFκB (nukleärer Faktor kappa B) phosphorylieren (Abbildung 1.6). In Folge dessen gelangt das aktivierte NFκB in den Zellkern und induziert dort die Expression verschiedener inflammatorischer Faktoren. Parallel dazu führt die Aktivierung der IRAK-Kinasen zu einer Phosphorylierung von Interferon-regulierenden Faktoren 3 und 7 (IRF-3 und -7), welche die Expression der für Interferon-(IFN)-α und IFN-β kodierenden Gene induzieren [35, 58].

(30)

Abbildung 1.6: Signaltransduktion von Toll-like Rezeptoren.

Eine Aktivierung von Toll-like Rezeptoren verläuft über die Adaptermoleküle MyD88 und TRIF und aktiviert die Transkriptionsfaktoren IRF-3, IRF-7, JNK, p38 MAPK, Erk und NFκB.

Diese wiederum induzieren die Expression von Typ-I-Interferonen (IRF-3 und -7) und Zytokinen (JNK, p38 MAPK, Erk und NFκB). Über spezifische Zytokinrezeptoren wird

(31)

1.5.2 Zytokine

Bei einem Kontakt von Erregern mit dem Körper ist eine effektive Modula-tion und KoordinaModula-tion der zellulären und humoralen Immunantwort erforderlich. Die dazu notwendige Kommunikation zwischen den beteiligten Zellen erfolgt einerseits über Zell-Zell-Interaktionen, andererseits über spezifische Botenstoffe, den Zytokinen. Diese werden von den verschiedensten Zellarten produziert, ins-besondere aber von Lymphozyten, Monozyten und Makrophagen. Zur Gruppe der Zytokine rechnet man heute neben den Interferonen (IFN), Interleukinen (IL) und Chemokinen auch die Tumornekrosefaktoren (TNF), die koloniestimulierenden Faktoren (CSF) und die transformierenden Wachstumsfaktoren (TGF) [35, 58].

1.5.2.1 Interferone

(32)

Tyk2 (Tyrosinkinase 2) und Jak1- (Januskinase 1) Kinasen am zytoplasmatisch lokalisierten Teil des IFNαR. In Folge dessen werden die Faktoren Stat-1 und Stat-2 (signal transducers and activators of transcription-1 und -2) ebenfalls phos-phoryliert und bilden einen Komplex mit dem Protein 48 (p48). Dieser Komplex aktiviert im Nukleus die interferonstimulierten regulatorischen Elemente (ISRE) und somit die Expression der interferonstimulierten Gene (ISG). Diese überneh-men Aufgaben in einer Vielzahl von zellulären Abläufen, wie Angiogenese, Anti-körperprozessierung und -präsentation, Apoptose, Zellvitalität, Replikation, Ex-pression und Translation, Zellmetabolismus und ZytokinexEx-pression [35, 58]. Ne-ben dem JAK/STAT Signalweg werden darüber hinaus noch MAPK abhängige Kaskaden durch Interferone aktiviert [5, 70].

Aus der Gruppe der Typ-II-Interferone wurde bisher nur ein Vertreter näher beschrieben, das IFN-γ. Die Sezernierung von IFN-γ führt in den umliegenden Zellen über den IFN-γ Rezeptor (IFNγR) zur Bildung von phosphorylierten Stat-1 Homodimeren. Im Zellkern binden diese an die IFN-γ-kontrollierten interferonsti-mulierten regulatorischen Elemente und bewirken darüber eine Expression von MHC-Klasse-II Proteinen und Zytokinen. Das IFN-γ gilt als eines der zentralen Zytokine bei der Induktion der spezifischen Immunantwort [35]. Die

Typ-III-Interfe-rone werden in drei Subtypen unterteilt: IFN-λ1, -λ2 und λ3, auch bekannt als IL-29, -28A und -28B). Diese wirken auf ähnliche Weise wie Typ-I-Interferone über den JAK/STAT-Signalweg. Über den genauen Wirkmechanismus dieser Zytokine sind bisher jedoch nur verhältnismäßig wenige Details bekannt [35].

1.5.2.2 Interleukine

Die Bezeichnung „Interleukine“ leitet sich von der zuerst beschriebenen Funktion ab: „zwischen Leukozyten vermitteln“. Bisher sind mehr als 35 Interleu-kine bekannt. Sie sind schon in sehr geringen Konzentrationen (10-15 bis 10-10 mol/l) mit vielseitiger Funktion aktiv, wirken aber überwiegend als Regulatoren des Immunsystems. Aus der Gruppe der Interleukine sind über 35 Vertreter bekannt, sodass im Folgenden nur die wichtigsten Vertreter näher dargestellt werden [58].

IL-1 umfasst eine Gruppe von Zytokinen mit einem Molekulargewicht von

(33)

proteolytisch in die aktive Form überführt wird, hat eine Größe von 31 kDa. Es wird vor allem von Makrophagen, Endothelzellen, Keratinozyten und Korneaepithelzel-len gebildet und zählt zu den proinflammatorischen Zytokinen [71]. Zytokine dieser Gruppe aktivieren die Proliferation von Keratinozyten, Fibroblasten (IL-1α) und Endothelzellen (IL-1β), induzieren weiterere Zytokine und Akut-Phase-Proteine (IL-1α/β) und aktivieren neutrophile Granulozyten (IL-1α), Monozyten (IL-1β) und Lymphozyten (IL-1α/β) [35, 72].

IL-6 ist ein 26 kDa Glykoprotein, welches von den verschiedensten Zellen

wie Monozyten, Makrophagen, Endothelzellen, Epithelzellen und Fibroblasten gebildet wird [71]. Es bewirkt unter anderem als proinflammatorischer Faktor die Induktion von Fieber, die Synthese von Akut-Phase-Proteinen, die Proliferation von B- und T-Lymphozyten sowie die Induktion anderer Zytokine [72]. IL-6 wird nach jeder Art von Gewebezerstörung freigesetzt; die höchsten Spiegel werden im septischen Schock erreicht [73].

IL-10 ist ein antiinflammatorisches Zytokin mit einem Molekulargewicht von

18 kDa. Es wird in erster Linie von Monozyten und Lymphozyten sezerniert und reduziert die Expression von Zytokinen und MHC-Klasse-II Antigenen. Darüber hinaus steuert es die Vitalität von B-Zellen, deren Proliferation und Antikörperpro-duktion [71, 72]. Zudem induziert IL-10 die Expression von SOCS1- (suppressor of cytokine signalling 1) und SOCS3 Molekülen, welche inhibitorisch auf den JAK/STAT Signalweg und NFκB wirken [74].

1.5.2.3 Chemokine

(34)

einige zusätzlich aktivierend auf die Immunzellen. Die CXC-Chemokine macro-phage inhibitory protein 1α (MIP-1α), regulated upon activation, normal T-cell expressed, and secreted (RANTES) wirken dabei vor allem auf die neutrophilen Granulozyten, während die CC-Chemokine (IL-8, Interferon gamma-induced protein 10 (IP-10)) bevorzugt Monozyten und Makrophagen zur Einwanderung an den Entzündungsort stimulieren. Konstitutive Chemokine werden im Unterschied zu den inflammatorischen Chemokinen kontinuierlich in den lymphatischen Orga-nen gebildet. Sie sind an der OrgaOrga-nentwicklung, der Angiogenese und der Feinlo-kalisierung der Immunzellen in den Lymphknoten, im Thymus und anderen lym-phatischen Organen beteiligt [75, 76].

1.5.2.4 Tumornekrosefaktoren

(35)

1.6 Alternative Signaltransduktion

Im Gegensatz zu der These einer übergeordneten Rolle von Toll-like Re-zeptoren bei der Erkennung adenoviraler Vektoren ist eine TLR-unabhängige Induktion einer Immunantwort nicht auszuschließen [79]. In diesem Zusammen-hang sind in den vergangenen Jahren immer mehr alternative Signaltransduktionswege des angeborenen Immunsystems ins Augenmerk der immunologischen Forschung gerückt [80-85].

1.6.1 RIG-like Rezeptoren

Eine der besser bekannten Signalkaskaden wirkt bei der Detektion von zy-toplasmatischer RNA und basiert auf zwei Proteinen der RNA-Helikase Familie, RIG-I (retionic acid inducible gene I) und mda5 (melanoma differentiation associ-ated gene 5), als zytosolische RNA Detektoren [86]. RIG-I agiert außerdem als Rezeptor für adenovirale DNA [87]. Zusammen mit den Proteinen LPG2 (ATP abhängige RNA-Helikase DHX58) und Dicer bilden sie die Familie der RIG-like Helikasen (RLH; retinoic acid-inducible gene I (RIG-I)-like helicases) [84, 88]. RIG-I und mda5 besitzen jeweils zwei aminoterminale CARD-Domänen (caspase activation and recruitment domain) sowie einen als RNA-Helikase fungierenden Abschnitt, welcher aufgrund eines konservierten Aminosäuremotivs auch als DExD/H-Box bezeichnet wird. Beide Rezeptoren binden an doppelsträngige (ds)RNA, RIG-I auch an 5’-triphosphorylierte einzelsträngige (ss)RNA [35].

(36)

Abbildung 1.7: Signaltransduktion RIG-ähnlicher Rezeptoren.

Bei Aktivierung von RIG-like Rezeptoren erfolgt die Signaltransduktion über das Adapter-molekül IPS-1 und führt zu einer Aktivierung der Transkriptionsfaktoren IRF-3, IRF-7, JNK, p38 MAPK und NFκB. Diese wiederum induzieren die Expression von Typ-I-Interferonen

(37)

1.6.2 Inflammasomen

Neben den TLRs und RLR spielt darüber hinaus eine weitere Gruppe von Rezeptoren der angeborenen Immunabwehr, die Inflammasomen, eine wichtige Rolle bei der Detektion der adenoviralen DNA [89-92]. Dabei handelt es sich um einen Caspase-1 aktivierenden Multiproteinkomplex bestehend aus einem Re-zeptorprotein der NOD-like Rezeptoren (nucleotide binding and oligomerization domain (NOD)-containing protein 1 like receptor (NLR)) oder der HIN-200 Pro-teinfamilie (hematopoietic interferon-inducible nuclear antigens with 200 amino acids repeats) sowie dem Adaptermolekül ASC (apoptosis-associated speck-like protein containing a card) und der IL-1β prozessierenden Caspase-1 [90, 93, 94].

1.6.2.1 NOD-like Rezeptoren

Eine essentielle Gruppe von Rezeptoren des angeborenen Immunsystems stellen die NOD-like Rezeptoren dar. Dabei handelt es sich um eine Gruppe von mehr als 20 verschiedenen zytoplasmatischen PRRs. Ebenso wie die TLRs sind auch die NLRs in der Lage, ein weites Spektrum pathogener Substrate zu erken-nen (Flagellin, Lipopolysaccharide (LPS), Lipoteichonsäuren (LTA), Peptidoglykan (PGN), RNA, DNA, etc) [30, 95, 96]. Mitglieder dieser Gruppe werden anhand ihrer C-terminalen nucleotide oligomerization domain und leucine-rich repeat domain charakterisiert. Anhand ihres Aufbaus am N-terminus werden die NLRs in zwei Subfamilien unterteilt, die NLRCs und NLRPs. Die NLRCs besitzen eine N-terminale CARD-Domäne wohingegen die NLRPs mit einer Pyrin Domäne (PYD) ausgestattet sind [97]. Vertreter der NLRCs, wie zum Beispiel NOD1 und NOD2, induzieren mittels ihrer CARD-Domäne eine RIPK2 (receptor-interacting serine/threonine kinase 2) abhängige Aktivierung des MAPK Signalwegs und NFκB [95]. Die NLRPs hingegen bilden in der Zelle zusammen mit dem Adaptermolekül ASC und Caspase-1 einen Multiproteinkomplex, welches als Inflammasom bezeichnet wird [96, 98]. Das Adaptermolekül ASC besitzt ebenfalls ein Pyrin- und eine CARD-Domäne.

(38)

die Spaltung von pro-IL-1β. pro-IL-18 und pro-IL-33 in deren aktiven Formen IL-1β, -18 und -33. Aus der Gruppe der NLRs wurde bisher nur ein einziger Rezeptor, NALP3 (NACHT, LRR and PYD domains-containing protein 3), für die Erkennung pathogener Nukleinsäuren näher charakterisiert [30, 95] .

1.6.2.2 HIN-200 Proteine

Im Jahre 2009 wurde ein weiteres Protein, AIM2 (abscent in melanoma 2), erstmals näher als Bestandteil eines DNA erkennenden Inflammasom-Komplexes beschrieben [90]. AIM2 ist ein Protein der HIN-200-Familie, eine Familie interferoninduzierender Proteine mit N-terminaler PYD und C-terminaler HIN-200-Domäne (PYHIN), die konservierte Sequenzwiederholungen mit einer Länge von 200 Aminosäuren enthält. Über die genauen Funktionen dieser Proteinfamilie ist bisher nur wenig bekannt. Beschrieben wurden bisher die Regulation des Zell-wachstums, Funktionen als Transkriptionsregulator und Tumorsuppressor [99]. Mit Ausnahme von AIM2 sind die Mitglieder dieser Familie überwiegend im Zellkern lokalisiert [93]. Im Gegensatz zu NALP3 werden potentielle DNA-Liganden mittels der HIN-200-Domäne gebunden und somit eine Interaktion der PYD und der PYD des Adaptermoleküls ASC ermöglicht [93]. Die weitere Signalweiterleitung erfolgt ebenfalls über eine Caspase-1 vermittelte Aktivierung von IL-1β, -18 und -33 [93, 98].

(39)

Abbildung 1.8: Inflammasomabhängige Signaltransduktion.

(40)

1.6.3 DAI (DLM-1/ZBP1)

Neben den TLRs, RLRs und NLRs wurde mit dem Protein DAI (DNA-de-pendent activator of Interferon-regulatory factors) ein weiterer DNA erkennender Rezeptor beschrieben [83]. Unter dem Namen DLM-1 (tumor stroma and activated macrophage protein) wurde dieses überwiegend zytoplasmatisch lokalisierte Protein bereits von Fu et al. im Jahre 1999 erstmals erwähnt [103, 104]. Zwei Jahre darauf wurden zwei N-terminale Z-DNA-Bindedomänen beschrieben und das Protein als ZBP1 (Z-form DNA binding protein 1) bezeichnet [105, 106]. Takaoka et al. belegen darüber hinaus in einer Studie die eindeutige Rolle von DAI als Rezeptor für bakterielle und Kalbsthymus- sowie synthetische DNA (Poly(dA:T), poly(dG:C)) [83]. Des Weiteren ist DAI bei der zytosolischen Erkennung von doppelsträngiger DNA im Allgemeinen beteiligt [30]. Die Bindung von DAI durch einen DNA-Liganden induziert eine TBK1 abhängige Aktivierung von IRF-3 und -7 [30]. Außerdem erfolgt eine RIP-1 und -3 vermittelte Phosphorylierung von IκB und die damit verbundene Freisetzung von NFκB (Abbildung 1.9) [30, 107]. Genauere Details der DAI-vermittelten Signaltransduk-tion sind bisher jedoch noch unklar [108].

(41)

Abbildung 1.9: DAI-induzierte Signaltransduktion.

Eine Aktivierung von DAI führt zu einer Signaltransduktion über die Transkriptionsfaktoren IRF-3, -7 und NFκB. Diese wiederum induzieren die Expression von Zytokinen und

(42)

1.7 Zielsetzung

Im Rahmen der vorliegenden Arbeit sollten die molekularen Mechanismen der angeborenen epithelialen Immunabwehr in Folge des transienten kutanen adenoviralen Gentransfers untersucht werden. Dabei sollten die Bestandteile der adenoviralen Vektoren, welche für die Immunogenität der adenoviralen Vektoren ursächlich sind, näher charakterisiert werden und darüber hinaus eine detaillierte Beschreibung der an der Induktion der Immunantwort beteiligten Rezeptoren und Signaltransduktionsmechanismen erfolgen.

Für die Bestimmung der adenoviral induzierten Zytokinexpression wurden primäre humane Keratinozyten und HaCaT-Zellen mit adenoviraler DNA bezie-hungsweise adenoviralen Vektoren transfiziert bzw. transduziert. Daraufhin wurde die Zytokinexpression der Keratinozyten mittels qRT-PCR auf RNA-Ebene unter-sucht. Darüber hinaus wurden die in vitro generierten Daten in einem ex vivo Versuch mit Hilfe eines humanen Hautspannmodells (BO-Drum®) verifiziert. Die lokalen und systemischen Effekte des adenoviralen Gentransfers sollten darüber hinaus in einem murinen Modell untersucht werden. Dazu wurde immunkompe-tenten und athymischen, haarlosen Mäusen ein adenoviraler Vektor intradermal injiziert. Der Vektor trug das Transgen für das grün fluoreszierende Protein (GFP). Die Expression des Transgens wurde über einen Zeitraum von 19 Tagen in einer Kodak Imaging Station quantifiziert und darüber hinaus die Zytokinexpression mittels qRT-PCR quantifiziert.

(43)

2 Material und Methoden

2.1 Material

2.1.1 Herkunft der Zellkulturen

HaCaT-Zellen wurden 1988 am Deutschen Krebsforschungszentrum aus

primären Keratinozyten eines zweiundsechzigjährigen männlichen Patienten gewonnen [117]. Für die Herstellung einer Kultur von primären humanen Kera-tinozyten wurde Hautgewebe aus dem peripheren Bereich eines Melanoms auf dem Rücken des Patienten entnommen und von Fettgewebe und Dermisanteilen befreit. Daraufhin wurden die Zellen enzymatisch aus dem Zellverband gelöst und in modifiziertem „Minimum Essential Medium“ (MEM) mit hoher Ca2+ -Konzentra-tion (1,4 M) ausgesät. Anschließendes Langzeitwachstum bei geringer Ca2+ -Kon-zentration (0,2 M) ohne Passagieren der primären Zellkulturen und die Erhöhung der Wachstumstemperatur auf 38,5 °C führte zu einer spontanen Immortalisierung der Zelllinie. Die Bezeichnung „HaCaT“ ist angelehnt an die Entstehung der Zell-linie und steht für „Human adult Keratinocytes under low Calcium and increased

Temperature“. Die Zellen wurden freundlicherweise von Prof. Dr. Fusenig

(Deut-sches Krebsforschungszentrum, Heidelberg) zur Verfügung gestellt.

Die primären humanen Keratinozyten (HKC) wurden aus Hautgewebe iso-liert, welches aus dem Operationssaal der Klinik für Plastische Chirurgie und Schwerbrandverletzte des Klinikums Bergmannsheil bezogen wurde. Die Proben-entnahme wurde autorisiert durch die Ethikkommission der Ruhr Universität Bo-chum (Register-Nr. 2501). Angaben bezüglich Alter, Geschlecht und genaue Herkunft der HKC-Zellen sind in Tabelle 2.1 dargestellt.

(44)

Tabelle 2.1: Patientendaten zu den verwendeten primären Keratinozyten.

Nummer Geschlecht Geb.-Jahr Operation

200 w 1982 Abdominoplastik 201 w 1988 Mammareduktion 202 w 1976 Mammareduktion 203 w 1959 Mammareduktion 204 m 1970 Abdominoplastik 205 w 1972 Abdominoplastik 206 w 1959 Facelift 207 w 1987 Abdominoplastik 214 m 1983 Spalthaut 220 w 1943 Abdominoplastik 222 w 1979 Abdominoplastik 223 w 1955 Abdominoplastik 224 w 1965 Abdominoplastik 225 m 1962 Daumenamputation 226 w 1952 Mammaamputation 227 m 1977 Abdominoplastik 231 w 1954 Abdominoplastik 232 w 1967 Abdominoplastik 234 w 1966 Abdominoplastik 235 w 1986 Mammareduktion

241 m 1947 Nachresektion Tumor Hüfte

(45)

2.1.2 Versuchstiere

Die haarlose Maus (SKH-1/Hrhr) wurde 1926 zufällig in einem Londoner Zoo entdeckt. Ihr genetischer Defekt beschränkt sich auf ihr Erscheinungsbild. Bei Jungtieren setzt ab dem zehnten Tag nach der Geburt der Ausfall der ursprünglich normal anmutenden Behaarung ein. Innerhalb der darauf folgenden Tage verlieren sie ihr Haarkleid völlig. Die Mäuse sind euthymisch und immunkompetent [118].

Bei der athymischen Maus Foxn1Nu/Nu handelt es sich um eine 1966 erst-mals von Flanagan et al. beschriebene Mäuserasse, welche aufgrund einer Spontanmutation kein Fellwachstum aufwies [119]. Zwei Jahre später berichteten Pantelouris et al. über das Fehlen des Thymus in dieser Spezies [120]. Dies führt zu einem Mangel an T-Zellen und somit zu einer stark dezimierten, nur aus B-Zellen bestehenden Population von Lymphozyten in den Tieren.

2.1.3 DNA, Marker und Enzyme

Foxn1Nu (athymisch) Harlan, Horst (Niederlande)

SKH-1Hrhr (immunkompetent) Charles River, Sulzfeld (Deutsch-land)

Dispase Invitrogen, Heidelberg (Deutschland)

DNA Marker (100 bp) Invitrogen, Heidelberg (Deutschland)

DNase I Qiagen, Hilden (Deutschland)

Proteinase K Qiagen, Hilden (Deutschland)

Rat Tail Collagen, Typ I BD Biosciences, Heidelberg (Deutschland)

SuperscriptTM II Reverse Transkriptase Invitrogen, Heidelberg (Deutschland) Taq-Polymerase Qiagen, Hilden (Deutschland)

(46)

2.1.4 Chemikalien, Lösungsmittel und Inhibitoren

Adenin Calbiochem, Bad Soden

(Deutsch-land)

Agarose NEEO Ultra-Qualität Roth, Karlsruhe (Deutschland) Amphotericin B Fungizone PAA Laboratories, Coelbe

(Deutsch-land)

Bacillol AF Bode Chemie, Hamburg

(Deutsch-land)

Bay 11-7085 Sigma, Steinheim (Deutschland)

Bromphenolblau Sigma, Steinheim (Deutschland) Caesium Chlorid Sigma, Steinheim (Deutschland)

CASY®ton Schärfe System, Reutlingen

(Deutschland)

Diethylpyrocarbonat (DEPC) Sigma, Steinheim (Deutschland) Dimethylsulfoxid (DMSO) Sigma, Steinheim (Deutschland) Deoxyribonukleosid-triphosphat (dNTP) Invitrogen, Heidelberg (Deutschland) Dulbecco's Modified Eagle's Medium

(DMEM)

PAA Laboratories, Coelbe (Deutsch-land)

Dulbecco's Phosphate-Buffered Saline

(DPBS) PAA Laboratories, Coelbe (Deutsch-land)

Ethanol Merck, Darmstadt (Deutschland)

Ethylendiamintetraessigsäure (EDTA) AppliChem, Darmstadt (Deutschland)

Formaldehyd Merck, Darmstadt (Deutschland)

Fötales Kälberserum (FCS) Perbio, Bonn (Deutschland) FuGENE® HD Transfection Reagent Roche, Mannheim (Deutschland) GelStar® Nucleic Acid Stain Biozym, Oldendorf (Deutschland)

Glycerol AppliChem, Darmstadt (Deutschland)

Ham F-12 PAA Laboratories, Coelbe

(Deutsch-land) humaner epidermaler Wachstumsfaktor

(hEGF)

Sigma, Steinheim (Deutschland) Hydrocortison Sigma, Steinheim (Deutschland)

Insulin Sigma, Steinheim (Deutschland)

Isoproterenol Sigma, Steinheim (Deutschland)

Isofluran (Forene) Abbott, Ludwigshafen (Deutschland)

Kaliumchlorid Merck, Darmstadt (Deutschland)

Kaliumdihydrogenphosphat Merck, Darmstadt (Deutschland) Lachgas (N2O) Air Products, Hattingen

(Deutsch-land)

L-Glutamin PAA Laboratories, Coelbe

(Deutsch-land)

LY 294002 Sigma, Steinheim (Deutschland)

Natriumchlorid AppliChem, Darmstadt (Deutschland) Natriumdihydrogenphosphat Merck, Darmstadt (Deutschland) Natriumhydrogenphosphat AppliChem, Darmstadt (Deutschland) Oligonukleotidprimer TIB MolBiol, Berlin (Deutschland)

(47)

2.1.5 Fertige Versuchsansätze

Penicillin/Streptomycin (Pen/Strep) PAA Laboratories, Coelbe (Deutsch-land)

Pferdeserum Vector Labs, Burlingame (USA)

Reinstwasser Bergmannsheil, Bochum

(Deutsch-land)

RNAlater RNA Stabilization Reagent Qiagen, Hilden (Deutschland) Sauerstoff (O2) Air Products, Hattingen

(Deutsch-land)

SB 203580 Sigma, Steinheim (Deutschland)

siRNA Eurofins MWG Operon, Ebersberg

(Deutschland)

SP 600125 Sigma, Steinheim (Deutschland)

Stickstoff, flüssig (N2) Air Products, Hattingen

(Deutsch-land)

T3 (Trijodthyronin) Calbiochem, Bad Soden (Deutsch-land)

Tris-HCl Merck, Darmstadt (Deutschland)

Tyrphostin AG490 Sigma, Steinheim (Deutschland)

Wasserstoffperoxid (H2O2) Merck, Darmstadt (Deutschland)

X-tremeGENE siRNA Transfection

Reagent Roche, Mannheim (Deutschland)

Xylol Sigma, Steinheim (Deutschland)

β-Mercaptoethanol Sigma, Steinheim (Deutschland)

HotStar Taq-DNA Polymerase Kit Qiagen, Hilden (Deutschland) LightCycler® 480 SYBR Green I Master Roche, Mannheim (Deutschland) Proteome Profiler Mouse Cytokine Array

Kit, Panel A

R&D Systems, Wiesbaden (Deutschland)

QIAamp DNA Mini Kit Qiagen, Hilden (Deutschland) RNase Free DNase Set Qiagen, Hilden (Deutschland) RNeasy Mini Kit Qiagen, Hilden (Deutschland) SuperScript™ First-Strand Synthesis

System for RT-PCR

(48)

2.1.6 Geräte und weitere Materialien

Analysewaage BL600 Sartorius, Göttingen (Deutschland) Aura PCR-Werkbank Nalge Nunc, Wiesbaden

(Deutsch-land)

Biophotometer Eppendorf, Hamburg (Deutschland)

BO-Drum® Hautkammern Bergmannsheil, Bochum (Deutsch-land)

CASY® Cell Counter Schärfe System, Reutlingen (Deutschland)

CASY®cups Schärfe System, Reutlingen

(Deutschland)

Cell Strainer (100 μm) BD Biosciences, Heidelberg (Deutschland)

Combitips plus 10ml Eppendorf, Hamburg (Deutschland) Combitips plus 5ml Eppendorf, Hamburg (Deutschland) Cryotubes Nalgene Typ 5000 Omnilab, Bremen (Deutschland) Einmalkanülen Sterican, Gr. 1 Braun, Melsungen (Deutschland) Einmalpinzetten Servoprax, Wesel (Deutschland) Einmalpipetten (5 ml, 10 ml, 25 ml) TPP, Trasadingen (Schweiz)

Einmalskalpelle Nr. 23 Braun, Melsungen (Deutschland) Einmalspritzen (5 ml, 20 ml) Braun, Melsungen (Deutschland)

Eismaschine Ziegra, Isemhagen (Deutschland)

Elektrophorese Power Supply E861 Consort, Turnhout (Belgien) ES-Kompressen, steril, 10x10cm Hartmann, Heidenheim

(Deutsch-land)

Feinwaage RC210D Sartorius, Göttingen (Deutschland) Filtrationssystem PES, 0,2 µm (500 ml) TPP, Trasadingen (Schweiz) Gelelektrophoresekammer Bio-Rad, München (Deutschland) Glas-Pasteurpipetten Neolab, Heidelberg (Deutschland) Handschuhe Sempermed Gr. 7 steril Sempermed, Neuwied (Deutschland) Handschuhe Sempermed Gr. 8 steril Sempermed, Neuwied (Deutschland) Homogenisator Polytron PT3100 Kinematica, Littau-Luzern (Schweiz) Insulinspritzen U40 Braun, Melsungen (Deutschland) Kodak Imaging Station 4000MM Biostep, Jahnsdorf (Deutschland) Kompressen unsteril, 10x10cm Hartmann, Heidenheim

(Deutsch-land)

Kühlzentrifuge 5415R Eppendorf, Hamburg (Deutschland) LightCycler® 480 Roche, Mannheim (Deutschland) LightCycler® 96-well PCR-Plate BIOplastics, Landgraaf (Niederlande) MasterCycler® Gradient Eppendorf, Hamburg (Deutschland) Mikroskop (Axioskop 2 plus) Zeiss, Jena (Deutschland)

Parafilm M Roth, Karlsruhe (Deutschland)

Petrischalen Sarstedt, Nümbrecht (Deutschland)

Pipetten Neolab, Heidelberg (Deutschland)

(49)

Safe Seal Tips Premium Biozym, Oldendorf (Deutschland) Safe-Lock Eppendorf Tubes PCR Clean Eppendorf, Hamburg (Deutschland) Slide-A-Lyzer Cassettes 3-12ml Thermo Fisher, Schwerte

(Deutsch-land)

S-Monovetten EDTA 2,7ml Sarstedt, Nümbrecht (Deutschland) S-Monovetten Serum 7,5ml Sarstedt, Nümbrecht (Deutschland) Sterican Kanülen Braun, Melsungen (Deutschland) Sterilbank HS12 Heraeus, Tuttlingen (Deutschland) TPP-Filtrationssystem, 500ml TPP, Trasadingen (Schweiz) Ultrazentrifuge (Suprafuge 22) Heraeus, Langenselbold

(Deutsch-land)

UV-Küvetten Uvette Eppendorf, Hamburg (Deutschland) Vortex-Genie® 2 Roth, Karlsruhe (Deutschland) Wärmeschrank Kelvitron® Heraeus, Tuttlingen (Deutschland)

Wasserbad GFL, Burgwedel (Deutschland)

Zellkulturflaschen mit Filter TPP, Trasadingen (Schweiz) Zellkulturschalen TPP, Trasadingen (Schweiz) Zellkulturtestplatten, 12-well TPP, Trasadingen (Schweiz) Zellkulturtestplatten, 6-well TPP, Trasadingen (Schweiz)

Zellschaber TPP, Trasadingen (Schweiz)

(50)

2.1.7 Zellkulturmedien 890 ml DMEM 100 ml FCS (10 %)* 10 ml Pen/Strep (1 U/ml)* 970 ml DMEM 20 ml FCS (2 %)* 10 ml Pen/Strep (1 U/ml)* 536 ml DMEM 300 ml Ham´s F-12 100 ml FCS (10 %)* 20 ml L-Glutamin (4 mM)* 10 ml Pen/Strep (1 U/ml)* 10 ml Adenin (5 µg/ml)* 10 ml Isoproterenol (1 µM)* 10 ml Insulin (24,3 µg/ml)* 2 ml Hydrocortison (0,8 µg/ml)* 1 ml hEGF (20 ng/ml)* 1 ml T3 (1,346 ng/ml)* 616 ml DMEM 300 ml Ham´s F-12 20 ml FCS (2 %)* 20 ml L-Glutamin (4 mM)* 10 ml Pen/Strep (1 U/ml)* 10 ml Adenin (5 µg/ml)* 10 ml Isoproterenol (1 µM)* 10 ml Insulin (24,3 µg/ml)* 2 ml Hydrocortison (0,8 µg/ml)* 1 ml hEGF (20 ng/ml)* 1 ml T3 (1,346 ng/ml)* 880 ml DMEM 100 ml FCS (10 %)* 10 ml Pen/Strep (1 U/ml)*,1 10 ml Amphotericin B (2,5 µg/ml)* Serumreduziertes Keratinozytenmedium (2% FCS):

Bo-Drum® Medium (pro 1000 ml)

Keratinozyten Primärkulturmedium (pro 1000 ml)

Serumreduziertes Standardmedium (2% FCS): Komplettmedium (10% FCS):

Standard-Zellkulturmedium (pro 1000ml):

(51)

2.1.8 Oligonukleotide

Tabelle 2.2a: Charakteristik der Oligonukleotide.

(Abkürzungen: f = forward primer, r = rever-se primer, AT = annealing temperature; m = murin, h = human)

Sequenz [5´ - 3´] AT [°C] f: gaaactgcgaatggctcattaaa r: cacagttatccaagtaggagagg f: cgcggttctattttgttggt r: agtcggcatcgtttatggtc f: gctgcaccaaaagtctctcc r: tcaaacgtgaagggcttctt f: gaaggcatttgtgggaagaa r: ggtgtggaagagcagaaagc f: aaagcatggacgatttaccg r: atgatgttcccgtgtccaat f: acgtaaacggccacaagttc r: aagtcgtgctgcttcatgtg f: gaggtgacagccttctaccg r: tgcctcacgtagctcatcac f: taccatctacctgggcttcg r: gctccataaggaagcactcg f: acccacagcctggataacag r: ctctcctcctgcatcacaca f: tcaatgacctgcaagctgtc r: agcaattggcagaggaagac f: actgcctcaaggacaggatg r: agccaggaggttctcaacaa f: ccctatggagatgacggaga r: ctgtctgctggtggagttca f: gctgaccgaaacatggagat r: cagatctcaactccccggta f: ataagtccgagggcaccttt r: gtgactaccagcacccctgt f: aatgacgccctcaatcaaag r: tgggtatctcaggcatctcc f: gcaacgggaagattctgaag r: tgacaaacttctgcctgacg f: ttcgacacatgggataacga r: tctttcaacacgcaggacag f: caatgaggagacttgcctgg r: gcacagctctggcttgttcc f: ccggagaggagacttcacag r: tccacgatttcccagagaac f: tctgcagctctgtgtgaagg r: aatttctgtgttggcgcagt f: ggggcatggagaataactca r: tgcccatgttgctgttatgt f: caagcaagcatctggaacaa r: ttttcttggccttgatgacc f: tgcagagcaaggaatgtgac r: aggatgctggggaactcttt Zielgen

18S ribosomale RNA (human) h18S

60

18S ribosomale RNA (murin) m18S

60

Abscent In Melanoma 2 (human) hAIM2 60

Caspase-1 (human) hCASP-1 60

DNA-Dependent Activator of

IFN-Regulatory Factors (human) hDAI 60

Grün Fluoreszierendes Protein GFP 60

Interferon Regulatory Faktor 7 (human) hIRF-7

60

Interferon Regulatory Factor 3 (human) hIRF-3

60

Interferon α (murin) mIFN-α

62

Interferon β (human) hIFN-β

60

Interferon β (murin) mIFN-β

60

Interferon gamma-inducible Protein 16

(human) hIF16 60

Interferon-beta Promoter Stimulator 1

(human) hIPS-1 60

Interleukin 1α (human) hIL-1α

60

Interleukin 1α (murin) mIL-1α

62

Interleukin 1β (human) hIL-1β 60

Interleukin 6 (human) hIL-6

63

Interleukin 6 (murin) mIL-6

60

Interleukin 8 (human) hIL-8

63

Melanoma Differentiation-Associated

Gene 5 (human) hMda-5 60

Myeloid Cell Nuclear Differentiation

Antigen (human) hMNDA 60

Myeloid Differentiation Primary Response

Gene 88 (human) hMyD88 60

Interferon α (human) hIFN-α1

(52)

Tabelle 2.2b: Charakteristik der Oligonukleotide.

(Abkürzungen: f = forward primer, r = reverse primer, AT = annealing temperature; m = murin, h = human)

Sequenz [5´ - 3´] AT [°C] f: cttctctgatgaggcccaag r: gcagcaaactggaaaggaag f: gtcacgcaactgccagtaaa r: gcgtagccactgtagcatga hRIG-I f: gcaacagtgcagaggtgaaa 60 r: caaaagagcatccagcaaca hSTING f: tcaaggatcgggtttacagc 60 r: tggcaaacaaagtctgcaag hTRIF f: caggagcctgaggagatgag 60 r: ctgggtagttggtgctggtt

Toll-like Rezeptor 3 (human) hTLR-3 f: agccttcaacgactgatgct 60

r: tttccagagccgtgctaagt

Toll-like Rezeptor 7 (human) hTLR-7 f: ccacaaccaactgaccactg 60

r: ccaccagacaaaccacacag

Toll-like Rezeptor 8 (human) hTLR-8 f: gtttcctcgtctcgagttgc 60

r: tcaaaggggtttccgtgtag

Toll-like Rezeptor 9 (human) hTLR-9 f: cctattcatggacggcaact 60

r: gagtgacaggtgggtgaggt

Tumor Nekrose Faktor α (human) hTNFα f: aacctcctctctgccatcaa 62

r: ggaagacccctcccagatag

Retinoic Acid Inducible Gene 1 (human)

Stimulator of Interferon Genes (human) TIR-Domain-containing Adapter-inducing Interferon-β (human)

Zielgen

NACHT, LRR and PYD

Domains-Containing Protein 3 (human) hNALP3 60

Pyrin and HIN Domain Family Member 1

(53)

2.2 Methoden

2.2.1 Adenovirale Transduktion in einem in vivo Ansatz

Achtzehn weibliche SKH-1Hrhr- und Foxn-1Nu-Mäuse in einem Alter von sechs Wochen wurden zu Beginn der Versuche eingestallt, täglich visitiert und betreut. Die Tiere hatten freien Zugang zu Wasser und Futter und wurden bei 22°C, 65 % Luftfeuchtigkeit und einem kontinuierlichen zwölf Stunden Tag/Nacht Rhythmus gehalten. Alle Tierversuche wurden gemäß den Tierschutzrichtlinien der Bundesrepublik Deutschland sowie der Genehmigung von Versuchsvorhaben gemäß §8 Abs.1 Tierschutzgesetz (Aktenzeichen: 50.8735.1 Nr. 112/6; Landes-amt für Natur, Umwelt und Verbraucherschutz Nordrhein-Westfalen) durchgeführt. Vor Versuchsbeginn wurden die Tiere für zwei Wochen in Gruppen zu je fünf Mäusen gehalten. Sie wurden täglich auf ihr Sozialverhalten sowie auf ihre Ge-sundheit hin untersucht.

Zu Beginn der Versuche wurden die Tiere in sechs Gruppen mit jeweils n = 3 Mäusen eingeteilt und durch Inhalationsnarkose sediert. Auf dem Rücken eines jeden Tieres wurden jeweils vier Areale mit einer Fläche von einem Quadratzenti-meter markiert. An Tag 0 (Abbildung 2.1) wurden jedem Tier 1x1010 infektiöse Einheiten (IU) Ad-GFP (in 50 μl PBS) in jeweils zwei Areale intrakutan injiziert. In die beiden verbliebenen Areale wurden 50 μl PBS injiziert. An Tag 14 erfolgte eine Reapplikation derselben Virusdosierung in alle vier Areale (Abbildung 2.2).

Abbildung 2.1: Zeitachse der Versuchsdurchführung.

(54)

gesamten Versuchszeitraum die Transgenexpression via Kodak Life-Imaging Station detektiert und quantifiziert [121]. Dafür wurden die Tiere in Zeitabständen von zwei Tagen erneut durch Inhalationsnarkose sediert und auf der Life-Imaging Station positioniert. Es folgte eine Ablichtung der transduzierten Areale bei einer Belichtungszeit von 0,5 Sekunden (Durchlichtaufnahmen) und zehn Minuten (Fluoreszenzaufnahmen). Die Auswertung der generierten Daten wurde mit Hilfe der Kodak Imaging Software durchgeführt.

Abbildung 2.2: Transiente kutane adenovirale Transduktion.

Applikationsareale nach Transduktion einer haarlosen Maus. AdV+AdV: Doppelte Injektion von 1010 infektiösen Einheiten (IU) eines adenoviralen Vektors (Tag 0 und 14); PBS+AdV:

Applikation der Trägerkontrolle (PBS) an Tag 0 gefolgt von Adenovirusinjektion an Tag 14 (A). Makroaufnahme einer Injektionsstelle bei intrakutaner Injektion (B).

2.2.2 Isolierung und Kultivierung von primären humanen Keratinozyten

Abbildung

Updating...

Referenzen

Updating...

Verwandte Themen :