Iden Histaentifiziemintra

Volltext

(1)
(2)

„Was wir wissen,

ist ein Tropfen;

was wir nicht wissen,

(3)

Danksagung

Bei der Erstellung dieser Dissertation haben mir viele Menschen hilfreich und unterstützend zur Seite gestanden.

An dieser Stelle möchte ich mich bei den wichtigsten bedanken.

Mein besonderer Dank gilt Herrn Prof. Dr. B. Hovemann für die interessante Thematik dieser Arbeit und die erstklassige Betreuung. Die Bereitstellung eines optimalen Arbeitsumfeldes hat es mir ermöglicht sehr spannende und erfolgreiche Forschung zu betreiben. Zudem danke ich Ihm für das große mir entgegengebrachte Vertrauen.

Herrn Prof. Dr. Klemens Störtkuhl danke ich für die Übernahme des Koreferates.

Bei meinen Kollegen und Freunden Silvia, Steffi und Florian bedanke ich mich für die gute Zusammenarbeit und Unterstützung, welche zum hervorragenden Arbeitsklima beigetragen haben. Speziell danke ich Silvia für Ihre große Hilfe an der HPLC und Steffi und Florian für die Korrekturen an dieser Arbeit.

Meinem besten Freund Christian möchte ich sehr für die sportliche Ablenkung und das Kor-rekturlesen danken.

Meinen Eltern möchte ich danken für ihre uneingeschränkte Unterstützung in allen Lebensla-gen. Dank euch war es mir erst möglich meinen Weg bis hier zu gehen.

(4)

Teile dieser Arbeit wurden bereits veröffentlich: Guido Uhlenbrock and Bernhardt T. Hovemann

Monoamine Neurotransmitter Transporter Expression in the Drosophila Brain Poster - “The 11th European Drosophila Neurobiology Conference”

September 2006, Leuven, Belgium

Romero-Calderón, R.#, Uhlenbrock, G.#, Borycz, J.#, Simon, A.F., Grygoruk, A., Yee, S.K.,

Shyer, A., Ackerson, L.C., Maidment, N.T., Meinertzhagen; I.A., Hovemann, B.T., Krantz, D.E. (2008)

A Glial Variant of the Vesicular Monoamine Transporter Is Required To Store Hista-mine in the Drosophila Visual System

PLoS Genet. 2008 Nov;4(11):e1000245. Epub 2008 Nov 7. # Diese Autoren sind zu gleichen Teilen an der Arbeit beteiligt.

Uhlenbrock, G, Romero-Calderón, R., Borycz, J., Simon, A.F., Grygoruk, A., Yee, S.K., Shyer, A., Ackerson, L.C., Maidment, N.T., Meinertzhagen; I.A., Hovemann, B.T., Krantz, D.E. (2008)

A Glial Variant of the Vesicular Monoamine Transporter Is Required To Store Hista-mine in the Drosophila Visual System

Poster - “The 12th European Drosophila Neurobiology Conference” September 2008, Würzburg, Germany

Der Staubsauger des Botenstoffs Histamin

(5)

Inhaltsverzeichnis

Inhaltsverzeichnis ... I  Abbildungsverzeichnis ... VI  Tabellenverzeichnis ... IX  1. Einleitung ... 1  1.1 Das visuelle System von Drosophila melanogaster ... 1  1.1.1 Der morphologische Aufbau des visuellen Systems ... 2  1.1.2 Aufbau der Ommatidien ... 3  1.1.3 Die neuronale Superposition ... 4  1.1.4 Die Gliaschichten der Lamina in Drosophila melanogaster ... 5  Die Fensterglia ... 6  Die Pseudocartridgeglia ... 6  Die Satellitenglia ... 7  Die Epithelialglia ... 7  Die Marginalglia ... 8  1.1.5 Die Medulla ... 8  1.2 Der Neurotransmitter Histamin ... 9  1.2.1 Signalweiterleitung über eine gestufte Umkehrsynapse ... 10  1.2.2 Aufbau der histaminergen Synapse ... 11  1.3 Postulierter Transmitterkreislauf im Auge von Drosophila ... 13  1.4 Neurotransmittertransporter ... 16  1.4.1 Die Notwendigkeit von Transportern im visuellen System ... 16  1.4.2 Neurotransmittertransporter der solute‐linked carrier Familie 6 (SLC6) ... 17  1.4.3 Der vesikuläre Monoamin‐Transporter dVMAT ... 18  1.4.4 Der putative Neurotransmittertransporter inebriated (ine) ... 21  1.7 Aufgabenstellung und Zielsetzung ... 22 

2. Material und Methoden ... 24 

2.1 Material ... 24 

2.1 1 Chemikalien ... 24 

(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)

1. Einleitung

Für das Überleben von Insekten stellt die Wahrnehmung ihres Umfeldes eine extrem wichtige sensorische Funktion dar. Dabei spielt die visuelle Wahrnehmung eine zentrale Rolle. Die immense Bedeutung dieses Systems kann schon an der Größe des Facettenauges im Vergleich zum Rest des Kopfes erahnt werden. Hier werden visuelle Reize aufgenommen und weiterge-leitet. Das visuelle System muss auf sich ändernde Lichtverhältnisse reagieren und selbst mi-nimale Veränderungen in der Lichtintensität schnell registrieren und verarbeiten. Dies ist für fliegende Insekten unabdingbar und gewährleistet zudem eine schnelle Fluchtreaktion.

Auch wenn sich die Neuroanatomie des visuellen Systems von Drosophila und Säugetieren unterscheidet, sind doch viele molekulare Elemente der aminergen Neurotransmission kon-serviert (Blenau and Baumann, 2001; Corey et al., 1994; Pörzgen et al., 2001). Auf Grund dieser Tatsache stellt Drosophila melanogaster ein sehr gutes System zur Untersuchung der Mechanismen zur Regulation der Neurotransmission dar.

Die in Drosophila melanogaster verfügbaren molekulargenetischen Methoden eröffnen eine Vielzahl unterschiedlicher Möglichkeiten die Expression bestimmter Gene in spezifischen Zelltypen des Auges zu steuern, wie es sonst in keinem anderen Organismus möglich ist. Da-mit können gezielt Gene ein- und ausgeschaltet und die Wirkweise der von ihnen kodierten Proteine detektiert werden.

Zunächst beschreibe ich kurz den Aufbau des visuellen Systems von Drosophila

melanogaster. Hierauf aufbauend erörtere ich die Aufnahme visueller Reize und deren

Wei-terleitung. Die Rolle des Neurotransmitters Histamin wird dargestellt und die Notwendigkeit eines Histamintransporters diskutiert. Hieraus ergibt sich direkt die Notwendigkeit der Identi-fizierung dieser Transporter und somit die Zielsetzung dieser Arbeit.

1.1 Das visuelle System von Drosophila melanogaster

(15)

1.1.1 Der morphologische Aufbau des visuellen Systems

Das visuelle System von Drosophila melanogaster besteht aus dem Komplexauge und den nachgeschalteten optischen Loben. Dazu gehören die Lamina, Medulla und der Lobula-Komplex.

In der elektronenmikroskopischen Aufnahme in Abbildung 1 (A) ist der Kopf der Taufliege mit dem Komplexauge dargestellt. Anhand dieser Aufnahme lässt sich die immense Bedeu-tung des Auges, das einen Großteil des Kopfes einnimmt, erahnen. In der Vergrößerung (B) ist die Oberfläche des Facettenauges, die aus der Cornea gebildet wird, gut zu erkennen. Die halbkugelförmige Gestalt mit je etwa 750 äquivalenten Einzelaugen ermöglicht auch im Randbereich des Sehfeldes eine gute Wahrnehmung, welche mit einem Linsenauge nicht zu erzielen wäre (Heldmaier and Neuweiler, 2003). Zudem ermöglicht diese Form ein extrem großes Sehfeld, da jedes Einzelauge eine andere räumliche Orientierung besitzt.

In dieser Anordnung erscheinen die einzelnen Facetten als regelmäßige Sechsecke, die dicht an dicht gepackt sind. Diese Wabenstruktur gleicht einem symmetrischen, kristallinen Aufbau und ist in der Natur eine häufig anzutreffende Form, da sie eine optimale Raumausnutzung ermöglicht.

Abbildung 1: Das Facettenauge von Drosophila melanogaster

Das Auge nimmt neben den Mundwerkzeugen den größten Anteil am Kopf ein (A). In der Vergrößerung ist der Aufbau aus vielen Facetten zu erkennen (B). Der horizontale Querschnitt durch das visuelle System von

Droso-phila melanogaster zeigt auch die nachgeschalteten optischen Loben (C). C: Cornea, R: Retina, L: Lamina, X:

äußeres optisches Chiasma, M: Medulla mit (d)istalem und (p)roximalem Teil, Lo: Lobula, Lp: Lobula Platte (Anhäuser, 2009; Meinertzhagen and O'Neil, 1991)

(16)

1.1.2 Aufbau der Ommatidien

Die von außen zu erkennende Wabenstruktur der Retina (Facettenauge) besteht aus etwa 750 Einzelaugen und zeigt die beschriebene komplexe Symmetrie. Jedes Segment des Facettenau-ges ist eine Struktur, die Ommatidium genannt wird und als kleines Auge bezeichnet werden kann, das eine feststehende Kollektion an Zellen besitzt. Diese Zellen sind in allen Ommatidien identisch an einer vertikalen Symmetrieachse angeordnet, die Abbildung 2 (A) zu entnehmen ist. Nahezu auf dieser Achse liegen die Photorezeptorzellen R7 und R8 überei-nander, die für das Farbsehen verantwortlich gemacht werden (Chou et al., 1996; Papatsenko et al., 1997). Kreisförmig werden diese von den Photorezeptorzellen R1 bis R6 umgeben, de-ren Hauptaufgabe in der Bewegungswahrnehmung liegt (Heisenberg and Buchner, 1977; Ya-maguchi et al., 2008). Jede Photorezeptorzelle besitzt ein rhodopsinhaltiges Rhabdomer, eine längliche Struktur, die den lichtsensitiven Teil der Zelle darstellt. Wobei die verschiedenen Photorezeptorzellen auf Grund ihrer Funktion unterschiedliche Formen des Rhodopsins tragen (Wernet et al., 2006). Zur Abschirmung gegen benachbarte Ommatidien sind verschiedene ommochrom- und pteridinhaltige Pigmentzellen um diese Struktur der Photorezeptorzellen angeordnet (Shoup, 1966). Somit wird eine autonome Funktion jedes Ommatidiums gewähr-leistet.

Abbildung 2: Aufbau eines Ommatidiums und neuronale Superposition

(A) Im Längsschnitt ist der Aufbau eines Ommatidiums zu erkennen. Es sind die Photorezeptorzellen R1-R8 dargestellt, deren Lage auch im Querschnitt gezeigt wird (modifiziert nach (Wolff and Ready, 1993)). (B) Die sechs Photorezeptorzellen R1-R6 eines Ommatidiums projizieren zu sechs unterschiedlichen cartridges in der Lamina (grau). Die äußeren Photorezeptorzellen von sechs benachbarten Ommatidien, die auf denselben Punkt im Raum gerichtet sind, vereinigen ihre Axone in einer Lamina-cartridge (farbig) (Morante and Desplan, 2005).

(17)

mechanosensorischen Borstenzellen abwechseln. Die Struktur aus sekundären und tertiären Pigmentzellen bildet das sechseckige Grundgerüst des Facettenauges und wird von benach-barten Ommatidien geteilt. Die Stabilität dieser Struktur wird zusätzlich durch Bindegewebs-zellen gewährleistet.

Jedes Ommatidium besitzt einen dioptrischen Apparat aus einer kutikulären Cornealinse und einem Kristallkegel. Die aus einer chitinartigen Substanz bestehende bikonvexe Cornealinse fokussiert das Licht auf die acht Photorezeptorzellen R1 bis R8. Die Axone der Photorezeptorzellen R1 bis R6 projizieren durch die fenestrierte Membran in die Lamina, in der eine erste Verschaltung der Information stattfindet.

1.1.3 Die neuronale Superposition

Die Axone der Photorezeptorzellen R1 bis R6 projizieren in die Lamina. Zusammen mit Mo-nopolarzellen sind sie Bestandteil der so genannten cartridges. Diese bestehen jeweils aus sechs Photorezeptoraxonenden, den fünf nachgeschalteten Lamina-Monopolarzellen L1 bis L5 und verschiedener Glia.

Die sechs äußeren Photorezeptorzellen liegen, wie bereits beschrieben, nicht zentral im Ommatidium, sondern trapezförmig um die senkrecht verlaufende Symmetrieachse herum. Auf Grund dieser Position erhält jedes Rhabdomer Informationen von einem anderen Punkt im Raum. Da das Auge eine gewölbte Oberfläche besitzt, sind jeweils sechs unterschiedliche Photorezeptorzellen von sechs benachbarten Ommatidien auf denselben Punkt im Raum ge-richtet. Die Axone dieser Rhabdomere konvergieren zu derselben Lamina-cartridge (Abbildung 2, B). Diese neuronale Superposition verbessert die Sensitivität und verringert das Hintergrundrauschen. Auf Grund dieser Verschaltung divergieren die sechs Axone der Photorezeptorzellen R1 bis R6 eines Ommatidiums immer zu verschiedenen cartridges (Mo-rante and Desplan, 2005).

(18)

Abbildun (A) Sche zellen L1 dargestell (B) Die L septate j Gliaschic Jede die risch ab (Meiner geometr Innerha 1.1.4 D Die Gli Entwick diesen Z In Flieg terschie (Saint M assoziie Die Lam proxima ng 3: Cartridg matische Dar 1 und L2. Jed lt sind. Modif Lamina besteh junctions (sj) chten vor. cv: eser cartrid bgeschirmt, rtzhagen an rische Anor alb der Lami Die Gliasch ia ist eine w klung und A Zellen viele gen wurde d edlichen Gli Marie and C erten Chiasm mina enthäl al die Fens ge und Gliasc rstellung einer e cartridge w fiziert nach (S ht aus sechs v ) miteinander coated vesicle dge-Einheite , wobei jed nd O'Neil, 1 rdnung wie ina befinden hichten de wichtige Ko Ausbildung e regulatoris die Glia des iasubtypen Carlson, 198 ma, in Dros lt sechs ver sterglia, Pse chichten der r cartridge mi wird von drei Z

tuart et al., 20 verschiedenen r verbunden. es. Modifizier en wird von de Gliazelle 1991; Mein sie in Abbi n sich weite er Lamina omponente der Nerve sche Aufgab s visuellen des ersten o 83a) und de ophila (Tix rschiedene S eudocartridg Lamina it sechs Photo Zellen der Ep 007) n Gliaschichte Tight junct rt nach (Edwar n drei Zelle e auch Tei ertzhagen a ldung 3 (A) ere Gliaschi in Drosop für die Fun nzellen bet ben zu. Systems be optischen N s zweiten o x et al., 1997 Schichten v geglia, die orezeptoraxon pithelialglia (g en. Die Zellen

tions (tj) kom rds and Meine en der Epit il von zwe and Pyza, 1 ) zu sehen is ichten mit u phila mela nktion des eiligt und i ereits gut be Neuropils, d ptischen Ne 7) charakter von Gliazel distale und nenden (R1-R6 g) umschlosse n der distale mmen in den ertzhagen, 201 thelialglia u ei benachba 1999). So en st. unterschiedl anogaster Nervensyst isoliert dies eschrieben. er Lamina, europils, de risiert werde len. Dies si d proximale 6) und den M en, von denen Satellitenglia n proximal 10) umgeben un arten cartri ntsteht eine ichen Aufg r tems. Sie is se. Zudem k So konnten in der Stub er Medulla, en.

(19)

Epithelialglia und die Marginalglia (Abbildung 3, B). Die Funktion und das Expressionsmus-ter dieser Gliatypen, so weit bekannt, werden nachfolgend beschrieben.

Die Fensterglia 

Die Fensterglia bildet eine Monoschicht direkt unterhalb der Basalmembran der Retina mit einer stark gefächerten Membranoberfläche. Es werden Auswüchse gebildet, die die Photore-zeptor-axone umschließen und bis in die Retina reichen (Saint Marie and Carlson, 1983a). Die Fensterglia liegt direkt oberhalb der Pseudocartridgeglia. Auch wenn daher häufig ange-nommen wird, dass sie Teil der Blut-Hirn-Schranke ist, hat sie grundsätzlich keine Barrierefunktion, da kolloidales Lanthan durch sie hindurch passieren kann (Saint Marie and Carlson, 1983b). Dies ist möglich, obwohl in der Fensterglia septate junctions vorhanden sind, die im Allgemeinen eine Barriere für gelöste Substanzen im extrazellulären Raum dar-stellen (Juang and Carlson, 1992). Jedoch befinden sich diese Barrieren ausschließlich zwi-schen den Gliazellen und den umschlossenen Photorezeptoraxonen und nicht zwizwi-schen den einzelnen Gliazellen. Die einzelnen Zellen dieser Schicht werden nur von Desmosomen und interzellulären gap junctions verbunden (Chi and Carlson, 1980).

Auf Grund des Vorkommens von Vesikeln, seiner Auswüchse an der apikalen Oberfläche und der gezeigten Aufnahme von Lanthan, könnte die Fensterglia der Stubenfliege anstelle einer isolierenden Funktion an der Aufnahme von Neurotransmittern oder Toxinen beteiligt sein. Die Pseudocartridgeglia 

Die Pseudocartridgeglia der Stubenfliege liegt direkt unterhalb der Fensterglia und besitzt viele horizontale Mikrotubuli. Sie ist gekennzeichnet durch lange Zellkerne und große Zell-körper, die bis zu 15 µm lang und 2-10 µm hoch werden, um die Axone der Photorezeptorzellen zu umschließen. Auch in dieser Gliaschicht sind Vesikel vorhanden, was eine Endozytose vermuten lässt (Saint Marie and Carlson, 1983a). Im Gegensatz zur Fensterglia besitzt die Pseudocartridgeglia viele septate junctions zwischen den einzelnen Zellen. Die große Oberfläche in Verbindung mit septate junctions lässt vermuten, dass es sich bei dieser Schicht um die subperineurale Glia (SPG) handelt, die auch das gesamte Gehirn umschließt und einen Teil der Blut-Hirn-Schranke darstellt (Bainton et al., 2005; Stork et al., 2008). Auch zwischen den Zellen der Glia und den Photorezeptoraxonen, die von ihr um-schlossen werden, befinden sich septate junctions (Saint Marie and Carlson, 1983b).

(20)

Ex-ßen Dextran-Molekülen am Nerv des dritten Larvenstadiums von Drosophila, der auch von der SPG umschlossen wird, bestätigt (Stork et al., 2008). Obwohl diese Schicht eine Barriere darstellt, bildet sie gap junctions mit der Fensterglia und der Satellitenglia, zwischen denen sie liegt. Auch zwischen den Zellen der Pseudocartridgeglia sind diese Verbindungen vorhan-den (Saint Marie and Carlson, 1983b). Das lässt zumindest in der Stubenfliege vermuten, dass ein interzelluläres Netzwerk existiert.

Die Satellitenglia 

Die Satellitenglia ist eine Klasse der Kortexglia, die in zwei Teile unterteilt werden kann. Dies ist zum Einen die distale Satellitenglia, welche die Zellkörper der Monopolarneurone umhüllt und zum Anderen die proximale Satellitenglia, welche die Axonbündel der Photorezeptorzellen und die Anfänge der Axone der monopolaren Interneurone zusammen-führt (Saint Marie and Carlson, 1983a).

Beide Gliaschichten sind auch in Drosophila vorhanden (Eule et al., 1995). In der Stubenflie-ge enthält der distale Teil Vesikel und beide Schichten bilden gap junctions mit den benach-barten Zellen aus. Daher kann auch diese Schicht als ein Teil des Glianetzwerkes angesehen werden. Von der Satellitenglia werden septate junctions, Desmosomen und tight junctions ausgebildet, wobei im proximalen Teil mehr septate junctions zu finden sind. Dies deutet da-rauf hin, dass die Satellitenglia möglicherweise auch Teil der Blut-Hirn-Schranke sein könnte. Die Epithelialglia 

Diese Gliaschicht erstreckt sich über die gesamte Tiefe der Lamina und es ist die einzige Zell-schicht, deren Zellkerne ausschließlich im distalen Bereich zu finden sind. Tight und gap

junctions werden sowohl zwischen den Zellen der Epithelialglia als auch an deren Ober- und

Unterseite, wo sie auf die Satellitenglia bzw. Marginalglia trifft, gebildet (Saint Marie and Carlson, 1983b).

Eine Gruppe von Photorezeptoraxonen und Lamina-Neuronen wird von einem Triplet von Epithelialgliazellen umschlossen und bildet eine cartridge (Meinertzhagen and O'Neil, 1991). Die Membranen der Gliazellen sind hier sehr stark gefaltet und verzweigt, wodurch eine gute Isolierung der cartridges erreicht und ein großer elektrischer Widerstand zwischen Lamina und Retina hergestellt wird. Des Weiteren werden von den Gliazellen Einstülpungen in die Axonenden der Photorezeptoren gebildet (Stark and Carlson, 1986).

(21)

scheint es möglich, dass der Epithelialglia die wichtige Aufgabe der Aufnahme des Neuro-transmitters an den Synapsen der Photorezeptoren zukommt. Zudem wird von den Zellen die-ser Gliaschicht das Protein HclB exprimiert (Gengs et al., 2002), das einen von zwei bekann-ten histamin-gesteuerbekann-ten Chloridkanälen darstellt. Die Funktion dieses Kanals ist noch nicht geklärt, er könnte jedoch in den Mechanismus der Histaminaufnahme involviert sein.

Die Marginalglia 

Das proximale Ende der Lamina bilden die überlappenden Zellen der Marginalglia. Jeweils eine Zelle umschließt die Axone der Monopolarzellen einer cartridge und bildet an deren Ein-trittsstelle Auswüchse in das Lamina-Neuropil (Eule et al., 1995). Die Tatsache, dass auch in dieser Gliaschicht Vesikel gebildet werden (Saint Marie and Carlson, 1983a), spricht für eine endozytotische Aktivität.

In der Marginalglia der Stubenfliege sind viele tight junctions zwischen den einzelnen Zellen und auch zwischen der Glia und den Axonen vorhanden. Desmosomen und gap junctions befinden sich ebenfalls zwischen den Gliazellen, jedoch keine septate junctions, die typisch für die Gliaschichten der Blut-Hirn-Schranke sind. Somit bildet die Marginalglia auf Grund vieler tight junctions die unterste Barriereschicht der Lamina (Saint Marie and Carlson, 1983b).

Diese Schicht bildet die Wachstumsgrenze für die Photorezeptorzellen R1-R6 und wird nur von den Monopolarzellen und den Axonen der Photorezeptorzellen R7 und R8 durchzogen, die in die Medulla projizieren.

1.1.5 Die Medulla

(22)

Die sehr komplexe Funktionsweise der Medulla ist bis heute nicht geklärt. Verhaltensexperi-mente deuten auf eine wichtige Rolle in der Verarbeitung des Farbsehens hin (Gao et al., 2008).

Analog zur Epithelialglia der Lamina wird Ebony auch in der Neuropilglia der Medulla exprimiert (Hovemann et al., 1998; Richardt et al., 2002). Die Rolle von Ebony und damit die der Epithelialglia wird später genauer betrachtet. Zunächst wird die Rolle von Histamin und die damit verbundene Art der Reizweiterleitung an den Photorezeptorzellen dargestellt.

1.2 Der Neurotransmitter Histamin

Histamin ist ein biogenes Amin, welches seit Beginn des 20. Jahrhunderts als Botenstoff im menschlichen Körper bekannt ist. Es konnte gezeigt werden, dass Histamin eine Schlüssel-funktion in der Regulation verschiedener KörperSchlüssel-funktionen hat. Es ist zum Beispiel beteiligt an der Kontrolle der Ausschüttung von Magensäure (Popielski, 1920) und spielt eine zentrale Rolle bei allergischen Reaktionen (Best et al., 1927).

Später wurde es auch als Neurotransmitter im optischen System von Drosophila erkannt, in-dem gezeigt wurde, dass es eine Hyperpolarisation postsynaptischer Zellen hervorruft (Hardie, 1987). Darüber hinaus reguliert Histamin eine Vielzahl physiologischer Prozesse in

Drosophila melanogaster und es scheint der universelle Neurotransmitter im visuellen System

aller Arthropoden zu sein (Hong et al., 2006; Melzig et al., 1996; Nässel, 1999; Stuart et al., 2007). Die Lokalisation von Histamin konnte mit Hilfe immuncytochemischer Detektionen mit einem Antiserum gegen ein Histamin-Carbodiimid-Protein-Konjugat gezeigt werden (Panula et al., 1988).

Des Weiteren konnte das Gen Hdc identifiziert werden, welches das Enzym Histidin-Decarboxylase (HDC) im visuellen System von Drosophila exprimiert (Burg et al., 1993). Dieses Enzym vermittelt die Umwandlung von Histidin zu Histamin, um es für die Neuro-transmission bereit zu stellen. Untersuchungen an Hdc-Mutanten haben gezeigt, dass die ge-störte Signaltransduktion durch das Füttern von Histamin substituiert werden kann (Melzig et al., 1998).

Durch Untersuchungen am visuellen System von Seepocken konnte durch Inkubation mit [3H]-Histidin die Bildung von [3H]-Histamin in den Photorezeptorzellen nachgewiesen

(23)

ständige Neusynthese, sondern primär durch einen Recyclingmechanismus für die Signal-transmission bereit gestellt wird (Morgan et al., 1999).

1.2.1 Signalweiterleitung über eine gestufte Umkehrsynapse

Die Photorezeptoren aller Tiere arbeiten mit stufenweiser Potentialänderung, wobei der Neu-rotransmitter kontinuierlich (tonisch) abgegeben wird. (Juusola et al., 1996). Je nach Art der Synapse findet dies entweder bei Lichtverstärkung oder -abnahme statt. Nach einer Depolari-sation erhöht sich der Transmitterausstoß im Invertebratenauge. Die Photorezeptoren von Vertebraten und Arthropoden exakt entgegengesetzt bezüglich ihrer Reaktion auf Lichteinfall. Die Photorezeptoren von Vertebraten depolarisieren in der Dunkelheit und hyperpolarisieren bei Lichteinfall. Diese Hyperpolarisation bewirkt eine Reduktion des Ausstoßes von Gluta-mat, wodurch eine verminderte Erregung der exzitatorischen OFF-Bipolarzellen und eine Desinhibierung der inhibitorischen ON-Bipolarzellen erreicht wird.

Im Gegensatz dazu sind die Photorezeptorzellen von Arthropoden depolarisiert, wenn Licht auf sie fällt und hyperpolarisieren (repolarisieren) bei vermindertem Lichteinfall (Abbildung 4).

Abbildung 4: Desinhibierung an der histaminergen Synapse von Drosophila

Diese extrem vereinfachte, schematische Darstellung zeigt die Hauptkomponenten der Reizweiterleitung an der ersten visuellen Synapse. Der Fokus liegt auf der Desinhibierung, daher werden die Adaptation bezüglich des elektrischen Potenzials der Photorezeptorzelle und der postsynaptischen Zelle ignoriert. Modifiziert nach (Stuart, 1999)

(24)

denen Depolarisierung der Photorezeptorzelle, gekoppelt mit einer Histaminfreisetzung, statt. Hierbei bewirkt eine Erhöhung der Lichtintensität auch einen verstärkten Histaminausstoß. Im Gegensatz dazu bewirkt eine Verminderung der Lichtintensität (Schatten) eine Re- oder Hyperpolarisation des Photorezeptors. Hierdurch wird die Freisetzung des inhibierenden Neu-rotransmitters Histamin verringert und die postsynaptische Zelle desinhibiert. Nachfolgend werden von der postsynaptischen Zelle exzitatorische Transmitter an die nachgeschaltete Zel-le abgegeben und es kommt zur SignalweiterZel-leitung (Abbildung 4) (Stuart, 1999). Diese Art der visuellen Weiterleitung ist extrem sensitiv. Schon eine geringe Reduzierung der Lichtin-tensität, die eine Änderung von nur wenigen hundert Mikrovolt hervorruft, kann einen Impuls in der nachgeschalteten Ganglionzelle bewirken (Shaw, 1975).

Bei der histaminergen Synapse von Photorezeptorzellen handelt es sich um eine inhibitorische Synapse, ähnlich zu der glutamatergen Synapsen an ON-Bipolarzelle von Vertebraten.

1.2.2 Aufbau der histaminergen Synapse

Innerhalb einer Lamina-cartridge wird die Information der Photorezeptoren auf die nachge-schalteten Monopolarzellen L1 und L2 weitergeleitet. Die Verbindungen werden über quer zur Achse der cartridge laufende dendritische Fortsätze der L-Axone hergestellt (Abbildung 5, A). Pro Terminal werden etwa 50 tetradische Synapsen gebildet, die Verbin-dungen mit vier postsynaptischen Elementen herstellen, wobei die Verknüpfungen mit den L1- und L2-Zellen invariant sind. Die zwei verbleibenden freien Stellen können von amakrinen, L3- oder Gliazellen eingenommen werden. So werden beispielsweise über α-amakrine Zellen Rückkopplungs-Verbindungen zu benachbarten Photorezeptorzellen her-gestellt (Meinertzhagen, 1996; Meinertzhagen and Sorra, 2001).

(25)

Nach der Exozytose werden die synaptischen Vesikel durch Endozytose recycelt und können neu mit Transmittern beladen werden (Südhof, 2004).

Abbildung 5: Cartridge-Horizontalschnitt und Photorezeptorsynapse

(A) Im Querschnitt der cartridge sind die Photorezeptoraxone von R1-R6 schematisch dargestellt. Sie umgeben die Axone der Monopolarzellen L1 und L2 und sind durch Paare aus Amakrin- (am) und T1-Zellen separiert. (B) In der Vergrößerung ist die tetradische Synapse dargestellt. Plattform (pl), Podest (pe), synaptische Vesikel (sv), Epithelialglia (gl), capitate projection (CP). Modifiziert nach (Hamanaka and Meinertzhagen, 2010)

Der Bereich der aktiven Zonen liegt unmittelbar an der Plasmamembran und ist definiert als Stelle, an der die Vesikel andocken und fusionieren, wodurch der Neurotransmitter abgegeben wird (Zhai and Bellen, 2004).

Der Aufbau dieser Zone ist bei allen bekannten Synapsen von Vertebraten und Invertebraten konserviert. Einzig die spezielle Form unterscheidet sich in den verschiedenen Organismen. An der tetradischen Synapse in Drosophila hat die aktive Zone eine als T-bar bezeichnete Struktur, die aus einer Plattform und einem Podest besteht (Abbildung 5, B).

Auf der postsynaptischen Seite der Synapse, getrennt durch den 30 nm breiten synaptischen Spalt, befindet sich die morphologische Struktur der postsynaptic density (PSD). Hier sind wichtige Komponenten für die Umwandlung von chemischen in elektrische Signale lokali-siert, wie die Transmitterrezeptoren und Ionenkanäle (Zhai and Bellen, 2004).

Es wurden die beiden Gene hclA (ort) und hclB in Drosophila identifiziert, die für histamin-gesteuerte Chloridkanäle kodieren. Jedoch konnte an der postsynaptischen Membran von L1 und L2 ausschließlich HclA (Ort) detektiert werden (Gengs et al., 2002; Gisselmann et al., 2002; Witte et al., 2002; Zheng et al., 2002).

(26)

erzeugt. Des Weiteren zeigt der Kanal nur eine geringe Affinität für Histamin (Kd = 60 µM in

der Stubenfliege), was ein schnelles Abdissoziieren erleichtert. Zuletzt besitzt der Kanal eine sehr kurze Öffnungsphase von nur 0,5 ms, wodurch ein Abfall der Histaminkonzentration schnell zum Schließen der Kanäle führt (Hardie, 1989).

Auf Grund der Depolarisierung der postsynaptischen Zelle durch die Verringerung des Neuro-transmitters Histamin, sind für eine schnelle Informationsweiterleitung von minimalen Licht-veränderungen verschiedene Voraussetzungen zu erfüllen. So ist die schnelle Detektion der aktuellen Histaminkonzentration entscheidend für die Signalbildung. Zudem müssen sich die postsynaptischen Kanäle schnell schließen können. Nicht zuletzt ist die schnelle Entfernung des Neurotransmitters aus dem synaptischen Spalt extrem wichtig. Um dieses zu erreichen, wird ein aktiver Transport von Histamin über einen oder verschiedene Transporter postuliert. Weiterhin könnte eine Umwandlung von Histamin in einen inaktiven Stoff die Effektivität der Synapse erhöhen.

Es wurde daher ein Histaminkreislauf postuliert, der diese Voraussetzungen erfüllt und im Folgenden erläutert wird.

1.3 Postulierter Transmitterkreislauf im Auge von Drosophila

Insekten besitzen einen besonderen Bedarf, den Neurotransmitter Histamin schnell aus dem synaptischen Spalt zu entfernen und zu inaktivieren, da das Fliegen eine hohe temporäre Auf-lösung des visuellen Systems erfordert, um eine ausreichend schnelle optomotorische Antwort zu generieren. Diese Notwendigkeit besteht insbesondere für Insekten, die schnelle Rich-tungswechsel während des Fluges durchführen. Eine effiziente Inaktivierung des Histamins könnte durch die Konjugation mit β-Alanin erreicht werden. Um das so gebildete Carcinin dem Neurotransmitterpool wieder zugänglich zu machen, müsste auch die Rückreaktion kata-lysiert werden. Tatsächlich konnten zwei Enzyme, Ebony und Tan, identifiziert werden, die diese Reaktionen katalysieren (Borycz et al., 2002; Richardt et al., 2003; True et al., 2005). Zunächst auf Grund ihrer Funktion als Katalysatoren bei der Melanisierung der Kutikula iden-tifiziert (Wright, 1987), konnte gezeigt werden, dass Ebony auch andere biogene Amine als Dopamin als Substrate akzeptiert (Richardt et al., 2003) und somit auch für die schnelle Ter-minierung der histaminergen Transmission in Frage kommt. Ebony ist verwandt mit bakteriel-len nichtribosomabakteriel-len Peptid-Synthetasen (Hovemann et al., 1998) und bindet β-Alanin an Histamin, um Carcinin zu generieren.

(27)

diese Funktion von Black ist seine Lokalisation in der Epithelialglia der Lamina (Phillips et al., 1993; Phillips et al., 2005). Allerdings konnten bis heute keine visuellen Phänotypen für

black-Mutanten identifiziert werden, da β-Alanin möglicherweise auch aus der Nahrung

auf-genommen werden kann.

Als Gegenspieler des Enzyms Ebony konnte das Gen tan identifiziert werden, dessen Produkt eine Carcinin-Hydrolase Aktivität aufweist und Ähnlichkeiten mit dem Enzym Isopenicillin-N N-Acetyltransferase (IAT) hat (True et al., 2005). Es ist ein Mitglied der Fa-milie der Cystein Peptidasen (Wagner et al., 2007) und wird durch posttranslationale Selbstprozessierung aktiviert (Aust et al., 2010).

Wichtig für die Funktionsweise von Ebony und Tan im visuellen System der Fruchtfliege ist ihre Lokalisation. Ebony konnte als cytoplasmatisches Protein identifiziert werden, das in der Epithelialglia, die die cartridges umhüllt, exprimiert wird (Richardt et al., 2002). Die Kolokalisation von ebony und black in der Lamina weist zusätzlich darauf hin, dass die Carcinin-Synthese exklusiv in den Zellen der Epithelialglia über die Konjugation von β-Alanin mit Histamin stattfindet (Abbildung 6).

Abbildung 6: Postulierter Histaminkreislauf im Auge von Drosophila melanogaster

(28)

Tan hingegen konnte in den Photorezeptorzellen detektiert werden (True et al., 2005). Über eine Antikörpermarkierung wurde die Expression dieses Enzyms auf das Cytosol der Zellen eingegrenzt (Wagner et al., 2007) was die Hydrolyse des Carcinins im Cytosol der Photorezeptoraxone nahe legt.

Die reziproke Lokalisation von Tan und Ebony in Neuronen bzw. Gliazellen impliziert einen komplexen Recyclingmechanismus für Histamin (Stuart et al., 2007).

Demzufolge wird Histamin von den Axonenden der Photorezeptorzelle in der Lamina in den synaptischen Spalt entlassen. An der postsynaptischen Membran wirkt es auf histamin-gesteuerte Chloridkanäle und muss danach zunächst von der Epithelialglia aufgenommen werden (1). Hier wird es durch Ebony mit β-Alanin, welches von Black bereitgestellt wird, zu Carcinin konjugiert. Dieses wird in den extrazellularen Spalt abgegeben (2) und von der Photorezeptorzelle wieder aufgenommen (3). Über das Enzym Tan kann es dort zum freien Histamin und β-Alanin hydrolysiert werden. Letzteres wird wahrscheinlich in die Gliazellen zurück transportiert (4+5), um dort wiederverwendet zu werden. Histamin wird hingegen in synaptische Vesikel verpackt (6), um wieder in den synaptischen Spalt ausgeschüttet werden zu können. Auch der direkte Transport von Histamin aus dem synaptischen Spalt zurück in das Photorezeptoraxon (7) kann nicht vollständig ausgeschlossen werden, obwohl es bisher dafür keine Indizien gibt (Abbildung 6).

Auf diese Weise wird Histamin effektiv und schnell inaktiviert und es ist keine schnelle Neu-synthese durch HDC notwendig.

Dieser Kreislauf ähnelt dem für Glutamat in Säugern. Hier wird Glutamat nach der Freiset-zung zunächst durch exzitatorische Aminosäure-Transporter (EAATs) in die umgebenden Gliazellen transportiert (Amara and Fontana, 2002; Deitmer, 2000; Kanner, 2006). Über Glu-tamin-Synthase wird es dort in die inaktive Form Glutamin transformiert (Martinez-Hernandez et al., 1977) und über ein Transportsystem zurück in die glutamatergen Neurone verbracht (Chaudhry et al., 1999; Reimer et al., 2000), um dort recycelt zu werden.

(29)

Um die exakten Mechanismen des histaminergen Signalweges zu verstehen, ist es notwendig auch die Transporter zu identifizieren, die die Speicherung, Freisetzung und das Recycling des Histamins und seiner Metaboliten ermöglichen.

1.4 Neurotransmittertransporter

Es sind zwei verschiedene Typen von Transmittertransportern an Neuronen bekannt, die beide eine entscheidende Rolle in der Regulation der Signaltransmission spielen.

Zunächst werden Botenstoffe nach ihrer Exozytose über plasmamembranständige Neurotransmittertransporter aufgenommen und aus dem synaptischen Spalt entfernt (Amara and Kuhar, 1993). Somit ist diese Transporterklasse essentiell an der Terminierung von Sig-nalen beteiligt (Torres et al., 2003). Die zweite Klasse von Transportern ist für die Aufnahme von Transmittern in sekretorische Vesikel in der Präsynapse und somit für den Transmittergehalt pro Vesikel verantwortlich (Daniels et al., 2004; Edwards, 2007; Reimer et al., 1998; Wojcik et al., 2004).

1.4.1 Die Notwendigkeit von Transportern im visuellen System

Der postulierte Histaminkreislauf im visuellen System von Drosophila melanogaster fordert bis zu sieben verschiedene Transportmechanismen. Zunächst muss Histamin in die Epithelialglia aufgenommen werden (1), um dort inaktiviert zu werden. Carcinin wird wieder abgegeben (2) und vom Photorezeptoraxon aufgenommen (3). Nach der Hydrolyse wird β-Alanin möglicherweise abgegeben (4) und von der Gliazelle zur Wiederverwendung aufge-nommen (5). Das zurückgewonnene Histamin muss in Vesikel geschleust werden (6), um wieder als Neurotransmitter fungieren zu können. Des Weiteren besteht die Möglichkeit, dass Histamin nach der Ausschüttung direkt wieder von der Photorezeptorzelle aufgenommen wird (7), um es an der Synapse bereit zu stellen.

Somit wird deutlich, dass für die Aufrechterhaltung des postulierten Transmitterkreislaufs verschiedene Transporter unabdingbar sind. A priori scheint es sinnvoll, nach Transportern in

Drosophila zu suchen, die diesen Kreislauf aufrecht erhalten und Histamin, Carcinin und

β-Alanin durch die Membranen schleusen.

(30)

1.4.2 Neurotransmittertransporter der solute-linked carrier Familie 6 (SLC6) Zu dieser Familie werden die Neurotransmitter/Symporter (NSS) und die Natrium-Neurotransmittertransporter-Familie (SNF) gezählt. Von diesen können Substanzen gegen einen Konzentrationsgradienten in die Zellen transportiert werden. Dies ist meist an einen elektrochemischen Natriumgradienten gekoppelt, kann aber auch von der extrazellulären Chlorid-konzentration abhängen (Chen et al., 2004; Nelson, 1998). All diese Transporter sind auf Grund ihrer Funktion als Transporter von Neurotransmittern, Aminosäuren oder Osmolyten durch die Plasmamembran entscheidend für die physiologische Homöostase. Zu den Substraten gehören zum Beispiel die Neurotransmitter GABA, Serotonin, Norepinephrin und Dopamin und ebenso die Aminosäuren Glycin und Prolin oder die Osmolyte Taurin und Betain. Es wurde gezeigt, dass Mutationen in einigen SLC6-Transportern lethal wirken oder zu schweren Defekten bei Drosophila führen (Gomeza et al., 2003; Tsai et al., 2004). Auch die orphan-Neurotransmittertransporter, deren Substrate noch nicht identifiziert wurden, ge-hören zu der Familie der SLC6-Transporter. Alle Mitglieder dieser Familie sind über konser-vierte Eigenschaften definiert. Zu diesen gehören zwölf Transmembrandomänen (TMDs) und hoch konservierte Aminosäuresequenzen in den Bereichen der TMDs 1, 2 und 4 bis 8. Ein großer glykosylierter, extrazellulärer loop zwischen den TMDs 3 und 4 gehört ebenfalls zu ihren Struktureigenschaften (Amara and Arriza, 1993; Nelson, 1998). Über Kristallstruktur-vergleiche konnte gezeigt werden, dass die konservierten Reste der TMDs 1, 6 und 8 an der Substrat- und Natriumbindung beteiligt sind (Yamashita et al., 2005).

(31)

Abbildung 7: SLC6-Transporter und Permeasen in Drosophila

Durch phylogenetische Analysen wurden verschiedene putative Transporter im Genom von Drosophila

melanogaster identifiziert. Diese wurden wenn möglich den Subfamilien der SLC6-Transporter und

Aminosäu-re-Permeasen zugeordnet. Modifiziert nach (Romero-Calderon et al., 2007; Thimgan et al., 2006)

Die restlichen identifizierten Aminosäure-Transporter gehören anderen SLC-Familien an. Die Mitglieder dieser Familien unterscheiden sich strukturell und bioenergetisch von denen der SLC6-Familie und können den Aminosäure-Permeasen zugerechnet werden (Abbildung 7, Permeasen) (Romero-Calderon et al., 2007).

Trotz der immensen Bedeutung in Säugetieren ist wenig über diese Proteine in Drosophila bekannt. Nur einige dieser Gene wurden bislang näher charakterisiert. Zu diesen gehören der Serotonin-Transporter dSERT (Corey et al., 1994; Demchyshyn et al., 1994), der Dopa-min-Transporter dDAT (Pörzgen et al., 2001) und der GABA-Transporter dGAT (Chen et al., 2004). Des Weiteren wurden die beiden orphan-Transporter bloated tubules (blot) (Johnson et al., 1999) und inebriated (ine) (Burg et al., 1996; Soehnge et al., 1996) kloniert. Für das Pro-tein Ine konnten bis heute keine Substrate eindeutig identifiziert werden. Allerdings wird es in einer Vielzahl von Zellen des Zentralen Nervensystems exprimiert (Burg et al., 1996; Huang et al., 2002; Soehnge et al., 1996).

Auch für den letzten Recyclingschritt, dem Wiederbeladen von Vesikeln mit Histamin, wird ein aktiver Transport postuliert. Hierfür ist mutmaßlich ein vesikulärer Transporter verant-wortlich. Tatsächlich konnte ein vesikulärer Monoamin-Transporter (dVMAT) in Drosophila identifiziert werden (Greer et al., 2005).

1.4.3 Der vesikuläre Monoamin-Transporter dVMAT

(32)

Seroto-Der aktive Transport von cytosolischen Monoaminen in Vesikel wird durch einen transmemb-ranen pH- und elektrochemischen-Gradienten getrieben. In Säugetieren konnten zwei VMATs identifiziert und charakterisiert werden (Erickson and Eiden, 1993; Erickson et al., 1992; Liu et al., 1992). Dies sind VMAT2, der in allen aminergen Neuronen des ZNS exprimiert wird und VMAT1, der hauptsächlich in neuroendokrinen Zellen lokalisiert ist (Peter et al., 1995; Weihe et al., 1994).

Die Proteindomänen, die in den VMATs und dem verwandten vesikulären Acetylcholin-Transporter (VAChT) für die Transportaktivität verantwortlich sind, unterscheiden sich von den Domänen, die für den Membraneinbau zuständig sind (Peter et al., 1996; Varoqui and Erickson, 1998). Hierbei liegen die spezifischen Bereiche für die Substrataffinität und Trans-portaktivität innerhalb der 12 TMDs. Der cytoplasmatische, carboxyterminale Bereich trägt hingegen Informationen für den Einbau in die Membran (Liu et al., 1999; Tan et al., 1998). Auch wenn die Kristallstruktur noch nicht gelöst werden konnte, weisen Sequenzvergleiche mit verwandten Proteinen darauf hin, dass es sich bei den VMATs um Transmembranproteine handelt, die eine Ähnlichkeit zu den Plasmamembran-Monoamin-Transportern aufweisen (Abbildung 8). Interessanterweise konnte gezeigt werden, dass alternatives Spleißen einen Einfluss auf die subzelluläre Lokalisation dieser Transporter hat (Poyatos et al., 2000; Sulli-van et al., 2004).

Abbildung 8: Vorhergesagte Sekundärstruktur von hVMAT2

(33)

Auch in Drosophila melanogaster konnten vesikuläre Monoamin-Transporter identifiziert werden. Es wurden zwei Spleißvarianten (DVMAT-A und B) detektiert, die sich in ihrem C-Terminus unterscheiden (Greer et al., 2005). In diesem Bereich liegt bei den VMATs von Säugern die Information für den Einbau in die Membran und auch in DVMAT-A sind diese konservierten Motive zu finden. Dies spricht für den Einbau dieses Proteins in die Vesikelmembran. Tatsächlich konnte DVMAT-A in dopaminergen und serotonergen Zellen des ZNS detektiert werden und ist kolokalisiert mit dem vesikulären Glutamat-Transporter in

Drosophila. Weiterhin wurde gezeigt, dass DVMAT-A Dopamin, Serotonin, Oktopamin,

Tyramin und Histamin als Substrate erkennt.

DVMAT-B hingegen besitzt eine andere C-terminale Domäne und wird nicht effizient in die Membran eingebaut (Greer et al., 2005).

Abbildung 9: Das dVMAT Gen und die Sekundärstruktur von DVMAT-B

(A) dVMAT-A und -B teilen sich denselben Translationsstart (ATG) und N-Terminus. Lediglich der untranslatierte Bereich und der C-Terminus unterscheiden sich. Ein Teil des letzten Exons wird in der A-Form heraus gesplissen und verbleibt in der B-Variante (blauer Bereich). Das Stopp-Kodon der B-Form befindet sich in diesem Bereich. (B) Eine schematische Darstellung zeigt die vorhergesagte Sekundärstruktur von DVMAT-B. Dargestellt sind die cytoplasmatischen Domänen (unten), die TMDs und die extrazellulären Bereiche (oben). Der C-terminale, DVMAT-B-spezifische Bereich ist hervorgehoben (magenta).

Das dVMAT Gen besitzt in der 5‘-Region zwei untranslatierte Exons die zur Spleißvariante A gehören (Abbildung 9, A). Die B-Variante besitzt ein separates untranslatiertes Exon. Aller-dings teilen sich beide Spleißvarianten dasselbe ATG. Beginnend mit diesem Start-Kodon werden zwei Proteine translatiert, die jeweils 12 TMD und einen großen lumenalen

loop zwischen der ersten und zweiten TMD besitzen (Abbildung 9, B), der charakteristisch

für VMATs ist.

(34)

ver-Die vorhergesagte Sekundärstruktur von DVMAT-B ist in Abbildung 9 (B) schematisch dar-gestellt. Der für diese Spleißvariante spezifische C-terminale Bereich ist besonders hervorge-hoben. Alle anderen Bereiche sind bei beiden Varianten identisch.

1.4.4 Der putative Neurotransmittertransporter inebriated (ine)

Es wird vermutet, dass das ine Gen einen putativen Neurotransmittertransporter kodiert. Es konnten zwei ine cDNAs identifiziert und sequenziert werden (Burg et al., 1996; Soehnge et al., 1996). Die längere cDNA, ine-RA, kodiert für das Protein Ine-P1 (943 Aminosäuren; 103,6 kDa, berechnet) und die kürzere, ine-RB, für Ine-P2 (658 Aminosäuren; 74,6 kDa, be-rechnet). Das Protein Ine-P1 besitzt an seinem N-Terminus eine ~300 Aminosäuren lange Sequenz, die Ine-P2 fehlt (Abbildung 10, A) und deren Funktion bislang nicht bekannt ist. Beide Proteine besitzen 12 TMDs und als Mitglieder der Na+/Cl--abhängigen Neurotransmittertransporter-Familie einen intrazellulären N- und C-Terminus sowie einen 60-70 Aminosäuren langen, extrazellulären loop zwischen der dritten und vierten TMD (Huang et al., 2002).

Abbildung 10: Aufbau von ine

(A) Putative Membrantopologie der zwei Isoformen des Ine-Proteins. Beide Isoformen sind identisch bis auf ihren N-terminalen Bereich. Hier besitzt Ine-P1 eine ~300 Aminosäuren lange Sequenz, die Ine-P2 fehlt. Dies geht auch aus dem Vergleich der Exonzusammenstellungen der beiden ine Isoformen ine-RA und ine-RB hervor (B). Es sind zwei bekannte Mutationen ine2 und ine3 eingezeichnet. Modifiziert nach (Huang et al., 2002)

Unter anderem wurden zwei Mutationen ine2 und ine3 identifiziert (Abbildung 10, B). Die

ine2 Mutation ist eine Nonsensmutation des Kodon 126 von ine-RA und somit spezifisch für diese Variante. Hingegen ist ine3 eine Deletionsmutation, die beide Transkripte betrifft.

Die Mutation des ine Gens bewirkt in Kombination mit der Mutation des Shaker Gens, wel-ches für die α–Untereinheit eines Kaliumkanals kodiert, einen Anstieg der neuronalen Erreg-barkeit. Zudem konnte ein Anstieg der Neurotransmitterabgabe am Motorneuron von

(35)

Phänotyp durch die gestörte Wiederaufnahme eines unbekannten Neurotransmitters verur-sacht wird. Hierfür spricht auch das abnorme Elektroretinogramm (ERG) von ine-Mutanten, bei denen im Photorezeptorpotential des ERGs eine starke Oszillation zu beobachten ist. Zu-dem sind die ine-ERGs durch eine insgesamt niedrigere Amplitude im Vergleich zum Wildtyp charakterisiert, ebenso wie durch verringerte on- und off-Transienten (Burg et al., 1996). Dies könnte für eine Rolle innerhalb des Histamin-Kreislaufs sprechen, allerdings konnte keine Aufnahme von radioaktiv-markiertem Histamin in Oozyten, die mit ine-RNA transfiziert wurden, beobachtet werden (Chiu et al., 2000). Weitere Studien legen nahe, dass es sich bei dem Ine-Protein um einen Carcinin-Transporter im visuellen System von

Droso-phila handeln könnte (Gavin et al., 2007; Stuart et al., 2007). Auch die Funktion als

Transpor-ter für β-Alanin kann nicht ausgeschlossen werden. 1.7 Aufgabenstellung und Zielsetzung

Über die Rolle des Neurotransmitters Histamin im visuellen System von Drosophila ist be-reits viel bekannt: Die Funktion und Art der Reizweiterleitung über histamin-gesteuerte Chloridkanäle konnte gezeigt werden. Ebenso scheint klar, dass Histamin über die Konjugati-on mit β-Alanin in das inaktive Carcinin überführt wird. Diese Umwandlung wird durch das Enzym Ebony in der Epithelialglia der Lamina vermittelt. Auch die Rückgewinnung über das Enzym Tan in den Photorezeptorzellen steht weitestgehend außer Frage.

Allerdings liegen auch noch viele Aspekte bezüglich des Abtransportes und Recyclings von Histamin an der Photorezeptorsynapse im Dunkeln. Explizit ist nichts über den Mechanismus bekannt, der verantwortlich für das Entfernen des Histamins aus dem synaptischen Spalt ist und somit die Aktivierung der Chloridkanäle über Histamin terminiert. Ebenso wurden bis heute keine Transportproteine identifiziert, die das inaktive Histamin (Carcinin) aus den Zel-len der Epithelialglia heraus und in die Photorezeptoraxone befördern.

Zudem kann der direkte Transport des Neurotransmitters aus dem synaptischen Spalt zurück in die präsynaptische Zelle nicht völlig ausgeschlossen werden. Des Weiteren ist der Mecha-nismus des Einschleusens des recycelten Histamins in Vesikel unklar. Zuletzt besteht die Fra-ge, ob der Neurotransmitter Histamin eventuell in Zellen gespeichert wird, um ihn bei erhöh-tem Bedarf an die Photorezeptoraxone abgeben und so auf eine hohe Lichtintensität reagieren zu können.

(36)

Neurotransmittertransporter im visuellen System von Drosophila melanogaster zu identifizie-ren und zu charakterisieidentifizie-ren, wurde im Rahmen dieser Arbeit verfolgt.

Deshalb wurden zunächst putative Histamintransporter über eine computergestützte Suche identifiziert und auf ihre Expression im visuellen System von Drosophila melanogaster über-prüft. Hierzu wurden die Techniken der RNA in situ Hybridisierung und RT-PCR verwendet. Diese Charaktierisierung gibt wertvolle Hinweise auf die Lokalisation der putativen Transpor-ter, jedoch kann hieraus keine exakte Aussage über die Position der translatierten Proteine getroffen werden. Um genaue Aussagen über die Funktion eines Transporters treffen zu kön-nen, ist die Kenntnis seiner zellulären Position aber unabdingbar.

Daher sollten zur exakten Lokalisation Antikörper gegen die Transporter-Kandidaten herge-stellt und immuncytochemische Analysen durchgeführt werden. Weiterhin sollten RNAi-Konstrukte der putativen Transporter hergestellt werden, um die Spezifität der Antikörper zu testen und die Expression auf bestimmte Zellbereiche und –typen eingrenzen zu können. Falls nötig sollten weitere Marker für die verschiedenen Zellschichten in der Lamina verwendet werden.

Nach der erfolgreichen Identifizierung und exakten Lokalisierung putativer Transporter muss deren Einfluss auf den Histamingehalt im Kopf von Drosophila analysiert werden. Zudem sollten deren Auswirkungen auf das Verhalten analysiert werden. Nur so kann zweifelsfrei der Einfluss dieser Proteine auf den Histaminhaushalt bewiesen und ihnen eine Funktion inner-halb des Histaminkreislaufs zugesprochen werden.

Auf Grund der bereits beschriebenen möglichen Einflüsse von DVMAT-B und Ine auf das visuelle System sollte ein spezielles Augenmerk auf diese putativen Transporter gelegt wer-den.

(37)

2. Material und Methoden

2.1 Material

2.1 1 Chemikalien

Tabelle 1: Verwendete Chemikalien

Chemische Substanz Hersteller

1-Butanol J.T. Baker, Deventer, NL

2-(4-(2-Hydroxyethyl)-1-piperazinyl)-ethansulfonsäure

(HEPES) Applichem, Darmstadt

5-Bromo-4-chloro-3-indoxylphosphat (BCIP) Roche, Grenzach-Wyhlen 5-Bromo-4-chloro-3-indoyl-β-D-galactosid (X-Gal) Roth, Karlsruhe

Acetonitril J.T. Baker, Deventer, NL

Agar-Agar Kobe I Roth, Karlsruhe

Agarose Roth, Karlsruhe

Ammoniumacetat (CH3COONH4) Merck, Darmstadt

Ammoniumperoxodisulfat (APS) Merck, Darmstadt

Ampicillin (Amp) Sigma, Seelze

Aqua-Phenol pH 4,5 Roth, Karlsruhe

Bis Tris Propan Fluka, Buchs, Schweiz

Bromphenolblau Serva, Heidelberg

Calciumchlorid (CaCl2) J. T. Baker, Deventer, NL

Calciumcitrat J. T. Baker, Deventer, NL

Calciumnitrat (Ca(NO3)2) Merck, Darmstadt

Chloramphenicol (Cl) Serva, Heidelberg

Chloroform (CHCl3) J. T. Baker, Deventer, NL

Coomassie Blau G Sigma, Deisenhofen

Coomassie Blau R Sigma, Deisenhofen

Desoxyribonukleosidtriphosphate (dNTPs) Fermentas GmbH, St. Leon-Rot

Diaminobenzidin (DAB) Sigma, Seelze

Diethylpyrocarbonat (DEPC) Sigma, Seelze

Dimethylformamid (DMF) J. T. Baker, Deventer, NL Dimethylsulfoxid (DMSO) J. T. Baker, Deventer, NL Dinatriumcarbonat (Na2CO3) Riedel-de Haën, Seelze

Dinatriumhydrogenphosphat (Na2HPO4) J. T. Baker, Deventer, NL

Dinatriumhydrogenphosphat-Dihydrat

(Na2HPO4 × 2 H2O) J. T. Baker, Deventer, NL

Dithiothreitol (DTT) Merck, Darmstadt

DNA-Größenstandards Fermentas GmbH, St. Leon-Rot

DNase, RNase-frei Fermentas GmbH, St. Leon-Rot

Dopamin Riedel-de Haën, Seelze

dulbecco's modified eagle medium (DMEM) PAA, Pasching

(38)

Ethanol (abs.) J. T. Baker, Deventer, NL

Ethidiumbromid Serva, Heidelberg

Ethyl-4-Hydroxybenzoat (Nipagin) J. T. Baker, Deventer, NL Ethylendiaminotetraacetat (EDTA) Merck, Darmstadt

Ficoll (400) Serva, Heidelberg

foetal calf serum Sigma, Seelze

Formaldehyd J.T. Baker, Deventer, NL

Formamid (CH3NO) Sigma, Seelze

Glukose Merck, Darmstadt

Glutamin Gibco BRL, Eggenstein

glycergel mounting medium Dako Cytomation, Hamburg

Glycerin Merck, Darmstadt

Hefeextrakt Roth, Karlsruhe

Heparin Serva, Heidelberg

Imidazol J.T. Baker, Deventer, NL

Isoamylalkohol Sigma-Aldrich, München

Isopropanol J. T. Baker, Deventer, NL

Isopropyl-β-D-thiogalactopyranosid (IPTG) Sigma, Deisenhofen

Kaliumacetat (KAc) Merck, Darmstadt

Kaliumchlorid (KCl) Merck, Darmstadt

Kaliumdihydrogenphosphat (KH2PO4) J. T. Baker, Deventer, NL

Kanamycin (Kan) Sigma, Seelze

Levamisol Serva, Heidelberg

Lithiumchlorid (LiCl) Merck, Darmstadt

Magermilchpulver Heirler, Radolfzell

Magnesiumchlorid (MgCl2) Riedel-de Haën, Seelze

Magnesiumsulfat (MgSO4) Merck, Darmstadt

Methanol J.T. Baker, Deventer, NL

Milchpulver Heirler, Radolfzell

mineral oil heavy Sigma, Seelze

mineral oil light Sigma, Seelze

N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimid

Hydrochlorid (EDAC) Sigma, Seelze

N,N,N,N’–Tetramethylethylendiamin (TEMED) Merck, Darmstadt

Natriumchlorid (NaCl) J. T. Baker, Deventer, NL Natriumcitrat (NaCi) J. T. Baker, Deventer, NL Natriumdihydrogenphosphat (NaH2PO4) J. T. Baker, Deventer, NL

Natriumdodecylsulfat (SDS) Serva, Heidelberg

Natriumhydrogencarbonat (NaHCO3) J. T. Baker, Deventer, NL

Natriumhydroxid (NaOH) J. T. Baker, Deventer, NL

nitro blue tetrazolium salt (NBT) Roche, Grenzach-Wyhlen

normal goat serum (NGS), hitzeinaktiviert Alexis, Grünberg

Nukleosidtriphosphate (NTPs) Fermentas GmbH, St.Leon-Rot

o-Phenylendiamin (OPD) Sigma, Seelze

Paraformaldehyd Riedel-de Haën, Seelze

Penicillin-G-Natrium-Salz Sigma, Seelze Polyethoxysorbitanmonolaurat (Tween 20) Aplichem, Darmstadt

(39)

Ponceau S Sigma, Deisenhofen

Propionsäure Fluka, Seelze

Rinder-Serum-Albumin (BSA) Serva, Heidelberg

RNase-Inhibitor Fermentas GmbH, St. Leon-Rot

Rotiphorese Gel 30 Roth, Karlsruhe

Salzsäure (HCl) J. T. Baker, Deventer, NL

Serva Blue G Sigma, Seelze

single strand DNA (ssDNA) aus Heringssperma Roche, Grenzach-Wyhlen

Sucrose J. T. Baker, Deventer, NL

Szintillationsflüssigkeit Roth, Karlsruhe

transfer RNA (tRNA) aus Bäckerhefe Roche, Grenzach-Wyhlen

Triethanolamin J. T. Baker, Deventer, NL

Tris-(hydroxymethyl)-aminomethan (Tris) Gibco BRL, Eggenstein

Triton X-100 Acros, Geel, BE

TRIzol® Invitrogen, Karlsruhe

Trypanblau Sigma, Seelze

tryptone enzymatic degest from caesin (Baktotrypton) Riedel-de Haën, Seelze Wasserstoffperoxid 35 % (H2O2) J. T. Baker, Deventer, NL

Xylencyanol FF Serva, Heidelberg

β-Mercaptoethanol Fluka, Seelze

2.1.2 Kits und Verbrauchsmaterialien Tabelle 2: Kits und Verbrauchsmaterialien

Kits und Verbrauchsmaterialien Hersteller

1,5 ml Reaktionsgefäße Sarstedt, Nürnbrecht

15 ml Röhrchen Sarstedt, Nürnbrecht

2 ml Reaktionsgefäße Sarstedt, Nürnbrecht

50 ml Röhrchen Sarstedt, Nürnbrecht

96-well-Platte Nunc, Wiesbaden

Blot-Papier Schleicher & Schuell, Dassel

Ceaprenstopfen 22 mm Greiner Bio-one, Solingen-Wald Dialyseschläuche, Typ 20/32 Roth, Karlsruhe

DIG-RNA-Labeling Mix Fermentas GmbH, St.Leon-Rot

Expand Long Template PCR System Roche, Mannheim

Filterpapier Schleicher & Schuell, Dassel

High Pure PCR Purification Kit Roche, Mannheim

JETstar 2.0 Genomed, Löhne

Küvetten (Kunststoff) Sarstedt, Nürnbrecht

Nitrocellulose-Filter (0,2 µm, ø 47 mm) Schleicher & Schuell, Dassel Nitrocellulose-Membran, 0,2 µm Schleicher & Schuell, Dassel Objektträger Superfrost Plus Thermo Scientific, Bonn

Parafilm Pechiney Plastic Packaging, USA

(40)

Pipettenspitzen 200-1000 µl Sarstedt, Nürnbrecht Pipettenspitzen 20-200 µl Sarstedt, Nürnbrecht

Protino Ni-TED 2000 Macherey–Nagel, Düren

PS-Röhrchen, 16 und 68 ml Greiner Bio-one, Solingen-Wald Röntgen-Entwickler-Konzentrat Adefo-Chemie GmbH, Dietzenbach Röntgen-Fixier-Konzentrat Adefo-Chemie GmbH, Dietzenbach

Sterilfilter Sarstedt, Nürnbrecht

Sterilstopfen Heinz Herenz Medizinbedarf GmbH, Hamburg SuperSignal® West Pico Chemiluminescent Substrate Thermo Scientific, Bonn

Whatman-Papier Macherey–Nagel, Düren

Sinfony™ Aktivator (Zahnfüllpaste) 3M ESPE AG, Seefeld

2.1.3 Verwendete Geräte und Software Tabelle 3: Verwendete Geräte

Gerät Modell Hersteller

HPLC:

Autosampler Triathlon Spark Holland B.V., Niederlan-de, Emmen

Computer Optiplex755 DELL, Frankfurt am Main

Elektrochemische Zelle (radial) BAS MF-1091 Bioanalytical Systems, UK, Warwickshire

Elektrochemischer Detektor EP30 Biometra, Göttingen HPLC Pumpe (isochratisch) Elite LaChrome-2130 Hitachi

Trennsäule (150 x 4,5 mm) 5 µm C18, 100 Å, nucleosil

column Macherey Nagel, Düren

Vorsäule (10 x 4,6 mm) 5 µm C18, 100 Å, nucleosil

guard column Macherey Nagel, Düren

Wasserbad 12B und VC-Thermostat Julabo, Seelbach ERG:

Impulsgeber Eigenfabrikat RUB Elektronik-Werkstatt

Oszilloskop HM507 HAMEG Instruments GmbH,

Mainhausen

Stereolupe WILDM3B Leica Microsystems, Wetzlar

Optomotorik:

Monitor Belinea101715 MAXDATA, Marl

UV-Polymerisationslampe Superlight -

Phototaxis:

Neonröhre L18W Coolwhite -

Allgemein:

Brutschrank Minitron AI72 Infors AG, Schweiz, Bottmingen

Brutschrank MB6 Binder GmbH, Tuttlingen

Dia-Scanner CanoScan FS2710 Canon GmbH, Krefeld

Geldokumentation redTM Alpha Innotech (Biozym), Hes-sisch Oldendorf

Heizblock Thermomixer 5436 Eppendorf, Hamburg

(41)

Horizontalschüttler Rockomat Tecnomara AG, Schweiz, Walli-sellen Isoelektrisches

Fokussierungssys-tem Multiphor II Amersham Pharmacia, Freiburg

Kaltlichtquelle KL1500 electronic Zeiss Germany, Jena

Kleinschüttler Vortex Genie 2 Bender & Hobein AG, Bruchsal

Konfokalmikroskop TSC2 Leica Microsystems, Wetzlar

Kühlzentrifuge Megafuge 1.0R Heraeus Holding GmbH, Hanau Lichtmikroskop mit UV-Einheit Axioplan Zeiss Germany, Jena

Magnet-Heizrührer RCT Ika-Labortechnik, Staufen

Magnetrührer RET Ika-Labortechnik, Staufen

Microfluidicer M110L MFIC Corp., USA, Newton

Mikrotom HM500 Thermo Scientific, Bonn

(Microm)

Objektiv (Konfokalmikroskop) HCX PL APOCS 63x1,4 Leica Microsystems, Wetzlar pH-Meter Digital-pH-Meter 646 Knick Elektronische Messgeräte, Berlin

Photometer C08000 Cell Density

Me-ter Biochrom Ltd., UK, Cambridge

platereader anthos 2010 anthos Mikrosysteme GmbH, Krefeld

Refraktometer - Zeiss Germany, Jena

Spannungsquelle 200/2,0 power supply BioRad, München Spannungsquelle ECPS 3.000/150 Pharmacia, Freiburg

Spannungsquelle EMBL PS143 HAZARD

Spannungsquelle VHW 50f-2b Zeiss Germany, Jena

Standzentrifuge

RC5C Rotoren:

GS3, HB4, SS34

Sorvall, Langenselbold

Stereolupe StemiSV6 Zeiss Germany, Jena

Thermocycler Mastercycler personal Eppendorf, Hamburg Tischzentrifuge Centrifuge 5417C Eppendorf, Hamburg Tischzentrifuge Centrifuge 5430 Eppendorf, Hamburg

Ultra-Turrax T25 JANKE & KUNKEL GmbH

IKA-Labortechnik, Staufen UV/VIS-Spektrometer Ultrospec 2000 Pharmacia Biotech, Freiburg

Vakuumpumpe UNO 008 B Pfeiffer Vacuum GmbH, Asslar

Wasserbad 12B und VC-Thermostat Julabo, Seelbach

Wasserbad 1083 CFL, Burgwedel

Isoelektrische Fokussierung:

Isoelectric Focusing System Multiphor II Amersham Pharmacia, Freiburg Spannungsquelle MultiDrive XL Amersham Pharmacia, Freiburg Wasserkühlung MultiTemp III Amersham Pharmacia, Freiburg Tabelle 4: Verwendete Software

Software Hersteller

(42)

Photosh Office 2 Confoca Sp107E Optomo Vector N WinRea 2.1.4 E Enzym Tabelle 5 Enzym Restrikt T4–Liga T4–Liga Calf Int Taq-DN Pfu-DNA Transcr Marker Tabelle 6 Marker GeneRu GeneRu my-Bud PageRu Abbildun A) GeneR Ladder de nologies hop CS2-4 007 al Software ( v2.19 otorik NTI Advanc ad v2.3 Enzyme u me 5: Verwendet tionsenzyme ase ase testine Alkal NA Polymera A-Polymera riptor Rever r 6: Verwendet uler™ 1 kb D uler™ 100 b dget 1 kb DN ler™ Presta ng 11: Verwe Ruler™ 1 kb er Firma Ferm GmbH, Krefe (LCS Light) ce v9.0 und Marke te Enzyme e line Phosph ase ase rse Transcri te Marker DNA Ladde p DNA Lad NA-Leiter ained Protei endete Marke DNA Ladder mentas GmbH eld; D) PageRu ) er atase (CIAP iptase er dder in Ladder er r der Firma F H, St. Leon-Ro uler™ Prestai Adob Micr Leic HAM Univ Invit antho Hers Ferm Ferm Prom P) Ferm Ferm Ferm Roch Hers Ferm Ferm Bio-Ferm Fermentas Gm ot; C) my-Bud ined Protein L be Systems I rosoft Corpo a Microsyste MEG Instrum versität Heid trogen, Karls os Mikrosyst steller mentas GmbH mentas GmbH mega, Mannh mentas GmbH mentas GmbH mentas GmbH he, Mannheim steller mentas GmbH mentas GmbH Budget Tech mentas GmbH mbH, St. Leon dget 1 kb DNA Ladder der Firm

(43)

2.1.5 Antikörper

Tabelle 7: Verwendete Antikörper

Bezeichnung Beschreibung / Hersteller Verdünnung

guinea

pig-anti-Ine-P1 (224) Finalserum

Ine Antikörper aus Meerschweinchen

gerichtet gegen E. coli-exprimierten, N-terminalen Teil von Ine-P1 mit N-terminalem His-Tag Tier 224

Eurogentec, Seraing, Belgien

1:200 (Schnitt)

guinea

pig-anti-Ine-P1 (225) Finalserum

Ine Antikörper aus Meerschweinchen

gerichtet gegen E. coli-exprimierten, N-terminalen Teil von Ine-P1 mit N-terminalem His-Tag Tier 225

Eurogentec, Seraing, Belgien

1:200 (Schnitt)

guinea

pig-anti-Black

Black Antikörper aus Meerschweinchen Gerichtet gegen E. coli-exprimiertes

Black-Gesamtprotein Tier 197

Eurogentec, Seraing, Belgien

1:500 (Schnitt)

mouse-anti-Penta-His

Penta-His Antikörper aus Maus (Monoklonal)

Qiagen, Hilden 1:1000 (Blot)

PAN19C

Histamin Antikörper aus Kaninchen Produkt Nr. 22939

ImmunoStar, Inc., Hudson, WI, USA

1:500 (Schnitt)

rabbit-anti-Ebony

(4. Serum)

Ebony Antikörper aus Kaninchen

gerichtet gegen die 221 Aminosäuren lange

Peptidsequenz Gly438 bis Asp658 des Ebonyproteins AG Hovemann (Richardt et al., 2002)

1:500 (Schnitt)

rabbit-anti-Ine-P2

(2325) 1. Serum

Ine Antikörper aus Kaninchen gerichtet gegen die Peptidsequenz: H2N-MPNRQDYDAQSSKHS+C-COOH

von Ine-P2 Tier 2325

Eurogentec, Seraing, Belgien

1:100 (Schnitt)

rabbit-anti-Tan

Tan Antikörper aus Kaninchen

gerichtet gegen die zwei Peptidsequenzen: H2N-SSGKILPRRQAVPVLC-COOH

H2N-CPSETEPHCRLPLLYK-COOH

Eurogentec, Seraing, Belgien

1:1000 (Schnitt) 1:10000 (Blot)

rat-anti-DVMAT-B

DVMAT-B Antikörper aus Ratte gerichtet gegen die Peptidsequenz: H2N-GASVPDSDAEAGRTN+C-COOH

Tier 30 + 31 (2. oder 4. Serum) Eurogentec, Seraing, Belgien

1:200 (Blot, Schnitt)

rat-anti-Tan

Tan Antikörper aus Ratte

gerichtet gegen E. coli-exprimiertes Tan-Gesamtprotein mit N-terminalem His6

Eurogentec, Seraing, Belgien

1:100 (Schnitt)

AP-anti-DIG

Digoxigenin Antikörper aus Schaf mit Alkaline Phosphatase gekoppelt

Roche, Grenzach-Wyhlen

(44)

AP-anti-mouse

Maus Antikörper aus Ziege mit Alkaliner Phosphatase gekoppelt

(auch gegen Ratte 1:1000) Dianova, Hamburg

1:5000 (Blot) AP-anti-rabbit

F(ab´)2

Kaninchen Antikörper aus Ziege mit Alkaliner Phosphatase gekoppelt

Dianova, Hamburg

1:5000 (Blot) Cy2-anti-guinea pig

Meerschweinchen Antikörper aus Ziege, Cy2-markiert

Dianova, Hamburg

1:200 (Schnitt) Cy2-anti-rabbit Kaninchen Antikörper aus Ziege, Cy2-markiert Dianova, Hamburg 1:200 (Schnitt) Cy2-anti-rat Ratte Antikörper aus Ziege, Cy2-markiert Dianova, Hamburg 1:200 (Schnitt) Cy3-anti-rabbit Kaninchen Antikörper aus Ziege, Cy3-markiert

Dianova, Hamburg 1:1000 (Schnitt)

Cy3-anti-rat Ratte Antikörper aus Ziege, Cy3-markiert Dianova, Hamburg 1:200 (Schnitt) Cy5-anti-rabbit Kaninchen Antikörper aus Ziege, Cy5-markiert Dianova, Hamburg 1:200 (Schnitt) Cy5-anti-rat Ratte Antikörper aus Ziege, Cy5-markiert

Dianova, Hamburg 1:100 (Schnitt)

DyLight™649-anti-guinea pig

Meerschweinchen Antikörper aus Ziege,

DyLight™649-markiert (Anregung und Emission entsprechen Cy5)

Dianova, Hamburg

1:200 (Schnitt)

HRP-anti-guinea pig

Meerschweinchen Antikörper aus Ziege mit Peroxidase gekoppelt

Dianova, Hamburg

1:2000 (Blot) 1:4000 (ELISA) HRP-anti-mouse Maus Antikörper aus Ziege mit Peroxidase gekoppelt

Dianova, Hamburg 1:2000 (Blot)

HRP-anti-rabbit

Kaninchen Antikörper aus Ziege mit Peroxidase ge-koppelt

Dianova, Hamburg

1:2000 (Blot) 1:4000 (ELISA) HRP-anti-rat Ratte Antikörper aus Ziege mit Peroxidase gekoppelt Dianova, Hamburg 1:500 (Blot)

2.1.6 Oligonukleotide

Tabelle 8: Verwendete Oligonukleotide

Name Sequenz Anwendung

dVMAT-A/B-Exon8-XbaI (antisense) (Primer 05) TCTAGACTAATGGAGGCGGGCAGGAAG RNAi-Klonierung; in situ Hybrid. dVMAT-A/B-Exon8-XbaI (sense) (Primer 03) TCTAGACGCTTTTGGACGATCTTACCTGG RNAi-Klonierung; in situ Hybrid. dVMAT-A/B-Exon8-XhoI (sense) (Primer 09) CTCGAGCGCTTTTGGACGATCTTACC RNAi-Klonierung; in situ Hybrid. dVMAT-A-Exon1+2 (antisense) (Primer 01)

CGTTGGGCGAATGGGTTG in situ

(45)

dVMAT-A-Exon1+2

(sense) (Primer 02)

CTGGCCAGCGGCATTCAG in situ

Hybridi-sierung dVMAT-B-Exon9-Ende-XbaI (antisense) (Primer 10) TCTAGAGCTGAACTTAGGGCTAAAAACAATG RNAi-Klonierung; in situ Hybrid. dVMAT-B-Exon9-Ende-XbaI (sense) (Primer 06) TCTAGAAAGGTACGTATGGCCAGAGAGGC RNAi-Klonierung; in situ Hybrid. dVMAT-B-Exon9-Ende-XhoI (sense) (Primer 08) CTCGAGAAGGTACGTATGGCCAGAGAG RNAi-Klonierung; in situ Hybrid.

white intron (antisense) CTGAGTTTCAAATTGGTAATTGGACCCTTT Kontrolle

white intron (sense) GTGAGTTTCTATTCGCAGTCGGCTGAT Kontrolle Ine-P1 N-Term-BamHI

(forward) GGATCCATATGGCGGAGAACAAAGACG Klonierung

Ine-P1 N-Term-HindIII

(reverse) AAGCTTTGGTGGCGTCTGCGGATTG Klonierung

dVMAT-A ACCCAACCCATTCGCCCAACGA RT-PCR dVMAT-B AGGTACGTATGGCCAGAGAGGC RT-PCR Eaat1 (alle Spleivarianten) CGTCGATTGGCTACTGGATCGC RT-PCR Eaat2 (1. und 2. Spleißvariante) GGACATGGACATGGACACCACG RT-PCR ebony CCAAGAATCTGGGCGAGATCATCG RT-PCR hoe1 (alle Spleißvarianten) TTAGGATGGACCGCTCTGCTGG RT-PCR

hoe2 (1. Spleißvariante) CGGCAGTGGTGCTGATTTCGGT RT-PCR

(46)

2.1.7 Bakterienstämme Tabelle 9: Bakterienstämme

Bakterienstamm Genotyp Bezugsquelle

NovaBlue

endA1 hsdR17 (rK12-m K12+) supE44 thi-1

recA1 gyrA96 relA1 lac F′[proA+B+ lacIqZ ΔM15::Tn10] (TetR)

Merck KGaA, Darmstadt (Novagen)

Rosetta E.coli, F-, ompT, hsdSB (rB-mB-) gal dcm

pRARE2 (CamR) Merck KGaA, Darmstadt (Novagen)

2.1.8 Plasmide

Tabelle 10: Verwendete Plasmide

Plasmide Herkunft

pGEM®-T Easy Promega GmbH, Mannheim

pQE-82L Qiagen, Hilden

pWIZ (Lee and Carthew, 2003)

pFLC-I Berkeley Drosophila Genome Project

pOT2 Berkeley Drosophila Genome Project

Abbildung 12: pGEM®-T Easy Vector der Firma

Promega Abbildung 13: pQE-82L Vector der FirmaQiagen

Abbildung 14: pFLC-I Vektor für RH-Klone des

(47)

2.1.9 LB-Medium und Kulturplatten LB-Medium 10 g Pepton (Baktotrypton) 5 g NaCl 5 g Hefeextrakt 2 mM MgCl2 pro Liter H2O

Zur Selektion werden die entsprechenden Antibiotikamengen zugefügt. Agarplatten

1,5 % Agar-Agar in LB-Medium  

Abbildung 17: pWIZ Vektor (Lee and Carthew, 2003)

Abbildung

Updating...

Referenzen

Updating...

Verwandte Themen :